Atheism

[anis_z24]

Greetings,


Correct.



I've tried it - no response that I could detect.



Isn't that about the same as saying "if you want to believe in god, then he exists"?

Peace

Salam

I don't think you tried from your heart. You tried expecting nothing.
But expect and look and you will find.
There has to be an energy to direct, otherwise everything would be ciaos and ciaos does not last.
I know that you must have heard this example numerous times but then again here it is:
If there are pieces of a an expensive car. and you left them on their own for a million years. nothing would happen.
Think about this, we are still dealing with matter(meaning it does not matter what(matter)) This should lead you to think that something must have moved that matter to make the Universe.

[czgibson]

Greetings,

I've answered all of your points earlier on in this thread.

I don't think you tried from your heart. You tried expecting nothing.
But expect and look and you will find.

Isn't that about the same as saying "if you want to believe in god, then he exists"?

I know that you must have heard this example numerous times but then again here it is:
If there are pieces of a an expensive car. and you left them on their own for a million years. nothing would happen.
Think about this, we are still dealing with matter(meaning it does not matter what(matter)) This should lead you to think that something must have moved that matter to make the Universe.

What you've got there are anecdotal versions of the argument from design and the argument from causation.

These are very old arguments, and they only generally convince people who are already theists.

If you have a look through this and other threads on the existence of god you should be able to find several discussions of them.

Peace

[anis_z24]

Salam

Czgibson
"Isn't that about the same as saying "if you want to believe in god, then he exists"?"

No.
Its not like your tricking yourself to believe something that does not exist.
I see that you are very materialistic.
and I say dont do what the people of Moses(PBUH) said to him.
"we will not believe until we see God"
just explain how can anything be done on its own- and please dont refer me to other posts in your own words explain- thank You

[x Maz x]

Question (dated): 2003 - I have a friend that doesn't even believe in a god, and I said whatever I could, but her side of the argument was, that if everything came from something, and their was a creator of everything, then where did god come from. and I don't know what to say, I'm kinda stuck.


__


Bismillah Rahman Raheem

Thank you for writing and for your question. First let us begin with Basics Of Islam [Click.]
http://www.islamtomorrow.com/word/

Here are some important points to keep in mind and these should be used when you are answering questions about Islam:

First - Tell them that we are pleased they are asking about Islam. Say, "Thanks for asking me about my religion."

Second, tell them two important things about our religion:

1. As Muslims we cannot lie about anything, especially about our religion.
2. We have original recorded sources of our religion:


A) The Quran [click]
http://www.islamtomorrow.com/quran/


B) Teachings of Muhammad [click]
http://islamtomorrow.com/islam/muhammad.htm


This is a unique part of Islam, not available in any other ancient religions.


Now explain to them, sometimes "questions" contain misinformation. We must qualify what it is that someone is saying against what they are implying. We will need to straighten out the questions before giving answers.

And finally, ask them, "If during the answer, you hear yourself saying, "I didn't know that" or "This is good," then are you ready to worship your God and your Lord without and partners?

Tell them, "This what Islam is really all about. The most important subject is the worship of Almighty God, without any partners or associates or "gods" besides Almighty God."

Now we are ready to begin to give the answers.


Answer: 2003 - Sept 15 14:40 EST -

The question that atheists usually ask regarding our belief in God, vary to some degree, but they are quite predictable over all. Let us consider a few:

1. "If God created everything - then who created God?" (may Allah forgive me)

Answer:
(Remember to use the formula above - i.e.; "Thank you for asking me about my religion..." etc.)

According to the Quran, Allah tells us that He is the only creator and sustainer of all that exists and that nothing and no one exists alongside Him, nor does He have any partners. He tells us that He is not created, nor is He like His creation in anyway. He calls Himself by a number of names and three of them are:
A) The First - (Al-Awal)
B) The Last - (Al Akhir)
C) The Eternal, who is sought after by His creation, while He has no need from them at all. (As-Samad)
He always has existed and He never was created, as He is not like His creation, nor similar to it, in any way.

2. "How can you believe in God, when you can't see, hear, touch, smell, taste or even imagine what He is?"

Answer:
We know from the teachings of Muhammad, peace be upon him, that no one has ever actually seen God - at least not in this lifetime. Nor are we able to use our senses to make some kind of contact with Him. However, we are encouraged in Islam to use our senses and our common sense to recognize that all of this universe could not possibly come into existence on its own. Something had to design it all and then put it into motion. That is beyond our ability to do, yet it is something that we can understand.
We don't have to see an artist to recognize a painting, correct? So, if we see paintings without seeing artists painting them, in the same way, we can believe that Allah created everything without having to see Him (or touch, or hear, etc.).

3. "Can God do anything? - Can He make a rock so big that nothing can move it? - If He did make a rock so big that nothing could move it, would that mean that He couldn't move it too? Or would it be impossible for Him to make something so big that He couldn't move it?"

Answer:
Allah tells us that "Allah is capable of doing anything that He Wills to do." He can make a rock (or anything for that matter) that is so large or heavy that nothing in the entire universe can move it. As regards Allah "moving" it, He is not in the universe and He does not resemble His creation. Whenever He wants anything done, He merely says "Qun! Faya Qun!" (Be! And so it will be!)

4. "Where is God?"

Answer:
Some other religions teach that "God is everywhere." This is actually called "pantheism" and it is the opposite of our believe system in Islam. Allah tells us clearly that there is nothing, anywhere in the universe that resembles Him, nor is He ever in His creation. He tells us in the Quran that He created the universe in six "yawm" (periods of time) and then He "astawah 'ala al Arsh" (rose up, above His Throne). He is there (above His Throne) and will remain there until the End Times.
5. "Why did God create everything?"

Answer:
Allah says in His Quran that He did not create all of this for any foolish purpose. He tells us that He created us for the purpose of worshiping Him, Alone and without any partners.

6. "Is God pure, good, loving and fair? - If so, then where does evil, hatred and injustice come from?"

Answer:
Allah tells us that He is Pure, Loving, and absolutely Just in every respect. He says that He is the Best of Judges. He also tells us that the life that we are in is a test. He has created all the things that exist and He has created all that happens as well. There is nothing in this existence except what He has created. He also says in the Quran that He created evil (although He is not evil). He is using this as one of the many tests for us.

7. "Does God really have power of things? - If so, then why does He let people become sick, oppressed and die?"

Answer:
Oppression is something that Allah forbids for Himself to do to anyone and He hates it when anyone oppresses someone else. He does have absolute power over everything. He allows sickness, disease, death and even oppression so that we can all be tested in what we do.
8. "Can you prove there is a God?"

Answer:
Can you prove that you exist? Yes, of course you can. You merely use your senses to determine that you can see, hear, feel, smell, taste and you have emotions as well. All of this is a part of your existence. But this is not how we perceive God in Islam. We can look to the things that He has created and the way that He cares for things and sustains us, to know that there is no doubt of His existence.

Think about this the next time that you are looking up at the moon or the stars on a clear night; could you drop a drinking glass on the sidewalk and expect that it would hit the ground and on impact it would not shatter, but it would divide up into little small drinking glasses, with iced tea in them? Of course not.

And then consider if a tornado came through a junkyard and tore through the old cars; would it leave behind a nice new Mercedes with the engine running and no parts left around? Naturally not.

Can a fast food restaurant operate itself without any people there? That's crazy for anyone to even think about.

After considering all of the above, how could we look to the universe above us through a telescope or observe the molecules in a microscope and then think that all of this came about as a result of a "big bang" or some "accident?"

(see also "Quran" below)
9. "Does God know everything that is going to happen? - Does He have absolute control on the outcome of everything? - If so, how is that fair for us? Where is our free will then?"

Answer:
Allah Knows everything that will happen. The first thing that He created was the "pen" and He ordered the pen to write. The pen wrote until it had written everything that would happen. And then Allah began to create the universe. All of this was already known to Him before He created it. He does have absolute and total control at all times. There is nothing that happens except that He is in control of if.
There is a mistake in the question: "Free Will." Allah alone, has Free Will, He Wills whatever He likes and it will always happen as He wills. We have something called, "Free choice." The difference is that what Allah "Wills" always happens and what we choose may or may not happen. We are not being judged on the outcome of things, we are being judged on our choices. This means that at the core of everything will always be our intentions. Whatever we intended, is what we will have the reward for. Each person will be judged according to what Allah gave them to work with, how they used it and what they intended to do with it.

As regards the actual "Judgment Day" - Allah tells us that everything we are doing is being recorded and not a single tiny thing escapes from this record. Even an atom's weight of good will be seen on the Day of Judgment and even a single atom's weight of evil will be seen too.

The one who will bring the evidences against us will be ourselves. Our ears, tongue, eyes and all of our bodies will begin to testify against us in front of Allah on the Day of Judgment. None will be oppressed on that Day, none will be falsely accused.

He could have put everyone in their respective places from the very beginning, but the people would complain as to why they were thrown in Hell without being given a chance. This life is exactly that; a chance to prove to ourselves who we really are and what we would really do if we indeed had a free choice.

Allah Knows everything that will happen, but we don't. That is why the test is fair.

10. "If there is only one God, then why are there so many religions?

Answer:
Allah does not force anyone to submit to Him. He has layed out a clear path and then made it known to them the two ways (Heaven or Hell). The person is always free to make his or her own choice. There is not complusion in the way of "Islam." Whoever choses to worship Allah without partners and is devoted to Him and is obeying His commands as much as possible, has grasped the firm handhold that will never break. Whoever denies God and choses some other way to worship or not to believe at all, for them there is an eternal punishment that is most horrible (Hell).

All religions originated with Allah and then people began to add or take away from the teachings so as to take control over each other. Man made religions are an abomination before the Lord and will never be accepted. He will only accept true submission, obedience and in purity and peace to His commandments.

11. "How do you know that the Quran is really from God?"

Answer:

Muslims have something that offers the most clear proof of all, The Holy Quran. There is no other book like it anywhere on earth. It is absolutely perfect in the Arabic language. It has no mistakes in grammar, meanings or context. The scientific evidences are well known around the entire world, even amongst non-Muslim scholars. Predictions in the Quran have come true; and its teachings are clearly for all people, all places and all times. No one has been able to produce a book like it, nor ten chapters like it, nor even one chapter like it. It was memorized by thousands of people during the lifetime of Muhammad, peace be upon him, and then this memorization was passed down from teacher to student for generation after generation, from mouth to ear and from one nation to another. Today every single Muslim has memorized some part of the Quran in the original Arabic language that it was revealed in over 1,400 years ago, even though most of them are not Arabs. There are over nine million (9,000,000) Muslims living on the earth today who have totally memorized the entire Quran, word for word, and can recite the entire Quran, in Arabic just as Muhammad, peace be upon him, did 14 centuries ago.


More important links re: Islam - Research - Answers - Audio
www.Islamtomorrow.com/islam - www.IslamTomorrow.com/menu/ - www.IslamAlways.com - www.Islamtomorrow.com/live

Thanks again for your question. All good is from Allah & mistakes were from myself.
May Allah guide us in Truth, ameen.
Salam alaykum - Yusuf Estes

Hey there! Looks like you're enjoying the discussion, but you're not signed up for an account.

When you create an account, you can participate in the discussions and share your thoughts. You also get notifications, here and via email, whenever new posts are made. And you can like posts and make new friends.
Sign Up

[x Maz x]

http://www.existence-of-god.com/firs...-argument.html

InshAllah that is more of a logical conclusion on the existance of God on the first cause WalaykumAsalaam x

[czgibson]

Greetings,

"Isn't that about the same as saying "if you want to believe in god, then he exists"?"

No.
Its not like your tricking yourself to believe something that does not exist.

Why not? If you try to contact god expecting nothing, nothing will happen. According to you, if you try and do expect something, then something will happen. What's the difference between that and believing because you want to believe?

I see that you are very materialistic.

I am a materialist, but I mean that in a different sense than "I value material possessions over everything else". I mean it in the philosophical sense that "material objects are all that exist".

and I say dont do what the people of Moses(PBUH) said to him.
"we will not believe until we see God"

They sound very rational to me, although I'd extend that to include any of the senses.

just explain how can anything be done on its own- and please dont refer me to other posts in your own words explain- thank You

I referred you earlier to posts that were in my own words!

What do you mean by "how can anything be done on its own"?

Peace

[Hussein radi]

Ok, i got a question for you Czgibson. Prove to me that the quran is man words since you dont believe in god. And tell me how did a human know the future? And how did he know science.

[Ansar Al-'Adl]

Ok, i got a question for you Czgibson. Prove to me that the quran is man words since you dont believe in god. And tell me how did a human know the future? And how did he know science.

:sl: br. Hussein,
This topic is already being discussed in this thread:
http://www.islamicboard.com/comparat...-word-god.html
If you would like to contribute to the discussion please use the above thread; this thread is only on the topic of atheism.

:w:

[anis_z24]

Greetings,


Why not? If you try to contact god expecting nothing, nothing will happen. According to you, if you try and do expect something, then something will happen. What's the difference between that and believing because you want to believe?



I am a materialist, but I mean that in a different sense than "I value material possessions over everything else". I mean it in the philosophical sense that "material objects are all that exist".



They sound very rational to me, although I'd extend that to include any of the senses.



I referred you earlier to posts that were in my own words!

What do you mean by "how can anything be done on its own"?

Peace

Salam,
How do you expect to know that God exists when you deny him.(as you share the opinion of the people of Moses(PBUH). You can not create a false feeling -it won't even last. So when you feel something supernatural(God) its real.
If the universe is more vast than the human mind can grasp, surely there has to be a God , that one can't see in this life as he is greater than the universe.
- What I mean by saying how can anything be done on its own is what created the universe. Its too complex to happen by fluke and if its not by fluke something has made it so.

So explain where everything came from. Try not to turn this into a debate or an argument. Its nice if you think about what these posts(I know you are, (go furthur)) say not just repost.

Hope you find guidence.

[czgibson]

Greetings,

How do you expect to know that God exists when you deny him.(as you share the opinion of the people of Moses(PBUH).

I don't expect to know that god exists. Nor can anyone. Knowledge is only attained when all other possibilities have been proven wrong. (Some would say even that level of certainty wouldn't constitute knowledge - other, unforeseen possibilities might exist.)

Until I was eighteen I was an agnostic. If someone asked me "does god exist?" I would have said "I don't know". I'm not now claiming to know for certain that god doesn't exist, it's simply that I think it is massively unlikely that he does, and far more likely that he is a fiction of human creation. That's why I call myself an atheist.

You can not create a false feeling -it won't even last. So when you feel something supernatural(God) its real.

So you would deny that it is possible for people to have delusions, or to have feelings about something that turn out to be wrong?

If the universe is more vast than the human mind can grasp, surely there has to be a God , that one can't see in this life as he is greater than the universe.

That's the argument from ignorance. You can use that fallacy to "prove" anything. For instance: I believe that grasshoppers prefer the colour red to yellow. It hasn't been proved false, so it must be true!

What I mean by saying how can anything be done on its own is what created the universe. Its too complex to happen by fluke and if its not by fluke something has made it so.

What created the universe? I've no idea. I don't even know if the universe was actually consciously created by something. It's the ultimate mystery that humans face - I don't believe there's a question that can be asked to which the answer is more uncertain.

You believe you have the answer - Allah created the universe. The problem with that is that the only evidence you have to support that view is faith, or belief, which can never constitute knowledge.

So explain where everything came from.

Nobody knows.

Try not to turn this into a debate or an argument.

You are a monotheist, I am an atheist. How can this not be a debate or an argument? (I'd like to mention that neither of those words should imply any aggression on either side - arguing is an intellectual activity in this context, not a visceral one.)

Its nice if you think about what these posts(I know you are, (go furthur)) say not just repost.

I think carefully about everything that people say to me, and you are no exception. :)

Peace

[anis_z24]

Salam

true I am no exception. But I meant to say "reflect deeply about God".
I look back on what I say and well there are better ways to reword my posts.
Sorry for any confusement.

Now the best thing to do is find the common things between us as humans as I see this is going no where(The argument)
Lets start by saying that we both care that humans should have basic morals such as help, learing etc. (If you would like to add go ahead, lets build a better understanding of how we see life)

[x Maz x]

czgibson:
Brother in humanity, can you see the wind? no, so therfore how do you know it exists?...Religion is a beleif and surley Islam is the truth...can you imagine a factory without workers?..a boss? machines? therfore can you imagine a world without a being to maintain order in it? everything is in perfect order...the sun gos up the moon goes down and via versa...how can yee deny if you dont even wish to gain knowledge? and already have made your final verdict...WalaykumAsalaam [peace be with you also] x

[czgibson]

Greetings,

Brother in humanity, can you see the wind? no, so therfore how do you know it exists?

Wind can be observed. It can also be scientifically explained, being the movement of air from areas of different atmospheric pressure.

can you imagine a factory without workers?..a boss? machines?

Yes. It wouldn't produce anything, but it's still conceivable.

therfore can you imagine a world without a being to maintain order in it?

Yes, quite easily.

everything is in perfect order...

What about all the destruction in the world, whether caused by humans or natural events such as earthquakes? Do they represent order?

the sun gos up the moon goes down and via versa...

Well, that's what it looks like to us on Earth, although we know that that's not a precise description of what they do.

how can yee deny if you dont even wish to gain knowledge?

I always wish to gain knowledge. Learning is one of the most important things in my life.

and already have made your final verdict

Yes, I made my decision on the god question at around the age of eighteen. Before that I was an agnostic, waiting for any evidence that god existed to show itself.

Peace

[x Maz x]

You seem to take everything so materialisticly...
Yes. It wouldn't produce anything, but it's still conceivable.
Ha ha humrous...falling of my chair with laughter...wel what can i say other then vivid imagination...So then brother in humanity what are your views...how do you think all these beuatiful things around us came into form? a big bang humans evolved in monkeys an voila theres Earth??,
What about all the destruction in the world, whether caused by humans or natural events such as earthquakes? Do they represent order?
Veirly Allah gave man free will...and sinse your so intelligent to come up with the verdict then you tell me from a atheists point of view why natural disasters occur?...if man wishes to cause mishchief on Earth verily there is punishment and as for natural causes they are trials sent from thy Lord...
Well, that's what it looks like to us on Earth, although we know that that's not a precise description of what they do....okey Einstein care to expand on that further...sinse your telling me my eyes are decieving me :(
I always wish to gain knowledge. Learning is one of the most important things in my life.
Glad to hear it...now i comand you to revert LAUGH OUT LOUD...no seirously then if you wish to attain knowledge channel it to gainin knowledge about Islam and what it teaches you instead disregarding all FACTS concerning God and religion etc
State your reasons to why you think God doesnt exist and also refer back to the article i posted initially inshAllah [God-willing]
WalaykumAsalaam [peace be with you also] x

[*noor]

We believe in God because we have faith. But there are also signs of Allah's creation everywhere you look. Take a look at yourself....just something simple like your hand for example. Do you think that it just "happened." No......of course not! Some Higher Being created your hand, the rest of your body and everything esle around you.

Think about it. Say for example you are making a pizza. It doesnt make itself. You have to make the dough, add the tomatoes, cut the cheese, and put it all together. Its not done by itself. Some Body has to do it.

So Allah is the creator of all creations in this universe. His creations (us and other things, mountains, rivers, volcanoes, trees, plants etc.) did not just appear. They were created by Allah Almighty.

Salam

Peace.

[czgibson]

Greetings,

You seem to take everything so materialisticly...

Yep. That's because I'm a materialist.

Yes. It wouldn't produce anything, but it's still conceivable.
Ha ha humrous...falling of my chair with laughter...wel what can i say other then vivid imagination...

Are you serious? Are you unable to imagine an empty factory?

So then brother in humanity what are your views...how do you think all these beuatiful things around us came into form? a big bang humans evolved in monkeys an voila theres Earth??,

Pretty much, although I reckon the Earth existed before humans evolved.

What about all the destruction in the world, whether caused by humans or natural events such as earthquakes? Do they represent order?
Veirly Allah gave man free will...and sinse your so intelligent to come up with the verdict then you tell me from a atheists point of view why natural disasters occur?...

Why not have a look here?

Natural Disasters

Again, do you think these things are examples of order?

Well, that's what it looks like to us on Earth, although we know that that's not a precise description of what they do....okey Einstein care to expand on that further...sinse your telling me my eyes are decieving me :(

Why are you calling me Einstein? You don't need to be a genius to work this one out.

The sun and moon appear to rise and set due to the rotation of the Earth and our position on it relative to them.

I always wish to gain knowledge. Learning is one of the most important things in my life.
Glad to hear it...now i comand you to revert LAUGH OUT LOUD

Right...

...no seirously then if you wish to attain knowledge channel it to gainin knowledge about Islam and what it teaches you instead disregarding all FACTS concerning God and religion etc

I'm here on the forum to learn as much as I can about Islam. So far it's been very enlightening.

What "facts" am I disregarding?

State your reasons to why you think God doesnt exist and also refer back to the article i posted initially inshAllah [God-willing]

To find out why I don't think god exists, please see my previous posts in this thread and all the others where atheism is discussed.

I'll have another look at the article, but it's got lots of arguments that have been answered many times before.

Peace

[anis_z24]

Salam
I meant this for Czgibson, I think maybe you missed my post.
so here it is again(in case)

Salam

true I am no exception. But I meant to say "reflect deeply about God".
I look back on what I say and well there are better ways to reword my posts.
Sorry for any confusement.

Now the best thing to do is find the common things between us as humans as I see this is going no where(The argument)
Lets start by saying that we both care that humans should have basic morals such as help, learing etc. (If you would like to add go ahead, lets build a better understanding of how we see life)

[Muslimaatan]

we know that Allah exists cuz of all the things around us..all the creation , and the Qur'an.....faith..

[root]

we know that Allah exists cuz of all the things around us..all the creation , and the Qur'an.....faith..

Should you not have just said "faith". Since creation and the Quran in themselves are "faith based".

[x Maz x]

Are you serious? Are you unable to imagine an empty factory?
Hmm...let me think and i get back to you on that one...when i said that i meant that in a way sayin that if a factory with no workers etc...stil producing...then how can a Earth stil be maintain order etc...yes got the cleared up now...nexxxxxt
Pretty much, although I reckon the Earth existed before humans evolved.....Lauuuuuuuuugh out Loud..oh purleeeeeeeeeeeeees....yes whatever you say...i beleiev you entirley [sarcasm] what next we will evolve into dinasours?
Again, do you think these things are examples of order? Trials from Allah :)
Right...
Twas a joke my dear ol' codger!
The sun and moon appear to rise and set due to the rotation of the Earth and our position on it relative to them. Intresting now erm go and see what the Quran says about it :)
So far it's been very enlightening. Care to ellaborate?? Oh the facts your disregarding well erm the FACT God does exist :)
I sincerely suggest you go buy a copy of Zakir Naik's debate with Dr William Cmapbell..i obviously am not a renouned scholar to take up such debates to convice thy that there is a God..i am only 16 and still seeking knwledge but inshAllah i will provide you with more eveidence WalaykumAsalaam x

[The Ruler]

Should you not have just said "faith". Since creation and the Quran in themselves are "faith based".

if u luk closely a lot of the things on this world is faith based....relatnshiips wid ppl, trust n everythin is faith based....if it wasnt for faith, all of us wud v different opinions

:w:

[The Ruler]

:sl:

if heart is summink that just pumps blood then why would certain doctors explain certain situations as 'heartache' :? :? i know this isnt relevant to the previous discusion but i just thought about it so...:-\

:w:

[czgibson]

Greetings,

I sincerely suggest you go buy a copy of Zakir Naik's debate with Dr William Cmapbell.

You mean "The Bible and the Qur'an in the Light of Science"? I've seen that one - it's freely available on the net.

I wasn't impressed by either of them, to be honest. Zakir Naik has a very good memory, but very weak arguments.

Greetings Tagrid,

if heart is summink that just pumps blood then why would certain doctors explain certain situations as 'heartache'

I've never heard a doctor use that as an explanation - have you?

Peace

[x Maz x]

You mean "The Bible and the Qur'an in the Light of Science"? I've seen that one - it's freely available on the net.

I wasn't impressed by either of them, to be honest. Zakir Naik has a very good memory, but very weak arguments....I see a very high level of ignorance arising in you sir, why are you so against accepting what is true?...Zakir May Allah have mercy on him is a brilliant renowned speaker...if you disagree so be it..i shall not argue with you nomore...you continue beleiving what you think is righ...whatever floats your boat WalaykumAsalaam [peace be with you also] x

[czgibson]

Greetings,

I see a very high level of ignorance arising in you sir, why are you so against accepting what is true?

Whew! That's about the fourth time I've been insulted on here today.

Zakir May Allah have mercy on him is a brilliant renowned speaker

He's renowned among people who already believe the same things he does. He's not convincing to non-Muslims though.

Peace

[x Maz x]

Well we have our reasons :)...
He's not convincing to non-Muslims though....Wow funny you should say that...as i know of many atheists who welcome and applauded such a constructed debate but then again everyones different...Okey well farewell mis-guided souli must depart WalaykumAsalaam [Peace be with you also] x

[Hussein radi]

Czgibson, why do you completely deny god??!?!?!??!?

[------]

Czgibson, why do you completely deny god??!?!?!??!?

Coz that's his belief :rollseyes He's an Atheist Bro Hussein :p

[czgibson]

Greetings,

Czgibson, why do you completely deny god??!?!?!??!?

Mainly because I've studied philosophy, but there are lots of other reasons too.

Read the works of Hume, Nietzsche and Russell if you want to get a philosophical background to atheism. I'd be interested to hear your thoughts on what they have to say.

Peace

[------]

He's not convincing to non-Muslims though.

Maybe that's just from your point of view czgibson :)

[------]

Read the works of Hume, Nietzsche and Russell if you want to get a philosophical background to atheism. I'd be interested to hear your thoughts on what they have to say.

You believe people over faith?! :heated:

[anis_z24]

Salam,
I think that its up to Allah to decide whether or not Czgobson will find guidence.
Its really not the way to go on da waa to Islam by asking him so many times why Czgibson does not believe in God.
People came to Islam through trading and through seeing how Muslims treated everything.
So we must find a different way to help Czgibson find guidence than interogating him all the time.

I am not saying that dialog is not great, rather when people(includind myself) "why do you deny God"
I think there are better ways of wording that.

I hope everyone understands.

[Hussein radi]

Ansar al adl, nice! brother. i think that would keep czgibson quite for a longtime.

[extinction]

:sl:

By the way, Root has left the forum. That was rather unfortunate as he/she/it didn't have the chance to learn much,

Nope he/she/it is still very much around...

[root]

Yes "He" never left and I have consistently posted on this forum.......

[Muslim Soldier]

In surah yasin Allah talks about people like ******** (I wont mention the name coz you all know it)

He says because they deny the truth, he has put a chain over their face and a barrier behind and infront of them. HE goes on to say that your warnings wont affect them ¬Verse 8-10

I advice you all to waste time with our friend ********. Leave him alone! Let him be cursed for all eternity.

[------]

In surah yasin Allah talks about people like ******** (I wont mention the name coz you all know it)

Bro my brains dead.... cud u please enlighten me....Jazakallah... :D

[root]

In surah yasin Allah talks about people like ******** (I wont mention the name coz you all know it)

I think he means he wants to bury his head in the sand.

[Muslim Soldier]

I am talking about a member but I wont mention his name.You figure it out.

[root]

I am talking about a member but I wont mention his name.You figure it out.

Your contribution has been so valuable that I think I will convert to Islam as soon as. but then again, maybe not.

[The Ruler]

Your contribution has been so valuable that I think I will convert to Islam as soon as. but then again, maybe not.

dat was a sarcastic comment ryt :?....n sarcastic comments r NOT welcome in a formal argument :rollseyes

:w:

[Omar Khalil]

:sl:
My evidence stems from this fact: Look how perfect everything that exsist needs eachother to survive! Nothing on this beautiful planet can survive alone. Only Allah could have made something so perfect. The way the universe runs can not even be:okay: imagined by our minds.

[mirage41]

:sl:
My evidence stems from this fact: Look how perfect everything that exsist needs eachother to survive! Nothing on this beautiful planet can survive alone. Only Allah could have made something so perfect. The way the universe runs can not even be:okay: imagined by our minds.

Why do you have an appendix? Vermiform appendix - Wikipedia, the free encyclopedia

[Omar Khalil]

:sl: Some things only Allah (s.w.t.) knows about. I just believe whatever he put it in us for is important! Remember the Angels & Jinn wanted to ask Allah why He gave us "free will". Allah knows best!:)

Why do you have an appendix? Vermiform appendix - Wikipedia, the free encyclopedia

[mirage41]

:sl: Some things only Allah (s.w.t.) knows about. I just believe whatever he put it in us for is important! Remember the Angels & Jinn wanted to ask Allah why He gave us "free will". Allah knows best!:)

Oh, so when you see things that contradict your idea that "nature is a perfect creation" then you just say that its all a mystery?

[Omar Khalil]

:sl: Absolutly not! What I am trying to say is that man does not know everything! Actually, there are lots of things that we as creations can't comprehend! Just because we don't know or understand the reason...doesn't mean that one doesn't exsist.

Oh, so when you see things that contradict your idea that "nature is a perfect creation" then you just say that its all a mystery?

[mirage41]

:sl: Absolutly not! What I am trying to say is that man does not know everything! Actually, there are lots of things that we as creations can't comprehend! Just because we don't know or understand the reason...doesn't mean that one doesn't exsist.

But I asked you a specific question about the appendix. Man in fact DOES know about this. It is a remnant of the evolutionary process:
Vestigiality of the human appendix

Believers say things like "look at nature balance and perfection, there must be a god". But here's the truth - nature ISN'T balanced and perfect. Why do you think animals go extinct every few years? Because nature ISN'T balance. Take a closer look - it isn't that beautiful either, ever seen a cockroach?

[Omar Khalil]

:sl: the article I just read has many theories and guesses! Once again, I don't know why it's there..but it's there for a reason.By you showing me this article...your proving my point that everything has a reason! Nobody knows the true one though! If you have a belief why it is there, then why do you ask others? Shouldn't the question be...Does anyone else have a reason or theory why we have one?

But I asked you a specific question about the appendix. Man in fact DOES know about this. It is a remnant of the evolutionary process:
Vestigiality of the human appendix

Believers say things like "look at nature balance and perfection, there must be a god". But here's the truth - nature ISN'T balanced and perfect. Why do you think animals go extinct every few years? Because nature ISN'T balance. Take a closer look - it isn't that beautiful either, ever seen a cockroach?

[mirage41]

:sl: the article I just read has many theories and guesses! Once again, I don't know why it's there..but it's there for a reason.By you showing me this article...your proving my point that everything has a reason! Nobody knows the true one though! If you have a belief why it is there, then why do you ask others? Shouldn't the question be...Does anyone else have a reason or theory why we have one?

What? No. The articles title is "Vestigiality of the Human Appendix", there are not many conclusions in the article. Did you even read the title. It means the the appendix is a "vestige", "remnant", "remainder" of the evolutionary process. No there are many things in nature without any purpose.

[------]

No there are many things in nature without any purpose.

Name 1.

[Omar Khalil]

:sl: What's ugly to you, is beautiful and has a purpose for being here to me! I truely believe in Allah and all that HE has created. I might can't change your mind about this topic...but mine won't either. Your still a brother to me no matter what we disagree on. I'll love you for that reason always.:statisfie

[mirage41]

Name 1.

I just did! Can you read? THE APPENDIX. Whales have useless pelvis bones that show that they were one land mammals.

Vestigial structure - Wikipedia, the free encyclopedia Read up!

[root]

[QUOTE]

Quote:
Originally Posted by Islamic Kuri
Name 1.


I just did! Can you read? THE APPENDIX.

Whales have useless pelvis bones that show that they were one land mammals.[/QUOTE]
Vestigial structure - Wikipedia, the free encyclopedia Read up!

I just have to say this. Modern DNA Taxonomy delivered a big shock quite recently, actually the whale does have a useless pelvis bone & DNA comparisons showed that the closest living land ancestor to the whale is in fact the Hipopotomus...... The closest living ancestor of the hipoppotomus is the whale

[anis_z24]

Salam,
if every thing was perfect then we would be in heaven already

[------]

2:28 How can you deny Allah? Seeing that you were dead and He gave you life. Then He will give you death, then again will bring you to life (on the Day of Resurrection) and then unto Him you will return.

Respect to this verse! :thumbs_up

[------]

hedonistic

............:?

[IbnAbdulHakim]

do all atheists believe in evolution?

[HeiGou]

do all atheists believe in evolution?

I don't know, but if you didn't believe in God why would you believe the Earth was created 6000 years ago? At a basic level of a lot of people have trouble with the concept of Evolution from other species (although ironically pretty much everyone, even Believers, accept Descent with Modification), but apart from that sort of gut feeling we ain't related to monkeys, there is no rational reason, apart from Scripture, to dispute evolution and by and large no one much does.

[root]

When you consider the evidence for evolution one should ask reasonably how can we prevent evolution, nevermind trying to disprove it?

[IbnAbdulHakim]

When you consider the evidence for evolution one should ask reasonably how can we prevent evolution, nevermind trying to disprove it?

by evidence you are referring to adaptation of certain animals?

[root]

by evidence you are referring to adaptation of certain animals?

Choose your words carefully, I am referring to the adaptation of all life.

[IbnAbdulHakim]

Choose your words carefully, I am referring to the adaptation of all life.

really even humans :eek: ?

[root]

really even humans

Of course. Retro virus insertion matches between primate groups showing the same insertion point and the same degrading over time are extremely difficuly to explain other than through common descent. This of course is only a very small part of the scientific data.

[IbnAbdulHakim]

Of course. Retro virus insertion matches between primate groups showing the same insertion point and the same degrading over time are extremely difficuly to explain other than through common descent. This of course is only a very small part of the scientific data.

i see so you think that this similarity is evidence of humans being evolved thru primates?

[root]

i see so you think that this similarity is evidence of humans being evolved thru primates?

Put it this way. If a retrovirus misfired it's DNA insertion into you that rendered it's insertion obsolete, you would carry this for the rest of your life. Your future off-spring will also carry a complete copy of the misfired insertion, (hypothetically - 10,000 years from now) your genetical data will have propogated through a large chunk of man who are by long distance still related to you and would still carry "perfect copies" of the retro virus misfire.

If 15,000 years from now a single person wondered if he shared ancestory directly from you and submitted his DNA to analyse the marker that would be your insetion misfire point and the result was that the person did have the exact gene sequence that the virus inserted, what would you conclude about the relationship of this future human and his relationship to you.

Just out of interest!

[AzN..]

I didn't can you explain it to me please ?:D

[AzN..]

Oops was looking at the first page :hiding: sorry

[IbnAbdulHakim]

Put it this way. If a retrovirus misfired it's DNA insertion into you that rendered it's insertion obsolete, you would carry this for the rest of your life. Your future off-spring will also carry a complete copy of the misfired insertion, (hypothetically - 10,000 years from now) your genetical data will have propogated through a large chunk of man who are by long distance still related to you and would still carry "perfect copies" of the retro virus misfire.

If 15,000 years from now a single person wondered if he shared ancestory directly from you and submitted his DNA to analyse the marker that would be your insetion misfire point and the result was that the person did have the exact gene sequence that the virus inserted, what would you conclude about the relationship of this future human and his relationship to you.

Just out of interest!

whoah this is embarassin but can you say that simply? sorry, found it difficult to understand unless your saying that how can primates and humans hav the same gene?

[root]

whoah this is embarassin but anyway to say that simply? sorry, found it difficult to understand unless your saying that how can primates and humans hav the same gene?

Since you have not answered the question, perhaps I may draw a reasonable conclusion. If this hypothetical event occured within me, then I could only conclude that the ancestory alternatively that the person is a direct relative of mine.

As for humans and primates and especially chimps, yes they share a number of retrovirus insertions at the same letter sequence of the dna showing the same degrading over time. How is this possible? afterall the ONLY logical way that this could occur is by off-spring copies. Urangatangs also have them so the same insertions are present in these three primates. The fact further confirmed that urangutangs have less matches indicates they seperated form our ancestor before chimps and humans thus we conclude chimps as our closest living ancestor and the urangutang second.

To me, how can this be reasonably explained. The answer is the final nail in the creationist view that man does not have a common ancestor of primates.

[IbnAbdulHakim]

Since you have not answered the question, perhaps I may draw a reasonable conclusion. If this hypothetical event occured within me, then I could only conclude that the ancestory alternatively that the person is a direct relative of mine.

As for humans and primates and especially chimps, yes they share a number of retrovirus insertions at the same letter sequence of the dna showing the same degrading over time. How is this possible? afterall the ONLY logical way that this could occur is by off-spring copies. Urangatangs also have them so the same insertions are present in these three primates. The fact further confirmed that urangutangs have less matches indicates they seperated form our ancestor before chimps and humans thus we conclude chimps as our closest living ancestor and the urangutang second.

To me, how can this be reasonably explained. The answer is the final nail in the creationist view that man does not have a common ancestor of primates.

Ye they are closest but they are not one and the same, what i mean is there is no direct proof that we come from primates. For example two fishes of different species may look alike, the fact that they do may indicate they hav some of the same DNA or genetics, this however in no way indicates that one formed from the other. They are both still unique, both a different species altogether.

I hope that makes sence, cudnt use technical words like you :hiding:

[root]

Ye they are closest but they are not one and the same, what i mean is there is no direct proof that we come from primates.

OK, point taken perhaps I am failing to clearly express my reasoning.

For example two fishes of different species may look alike, the fact that they do may indicate they hav some of the same DNA or genetics, this however in no way indicates that one formed from the other

Your reasonably right in logic but not scientific data analysis and example would be that the closest living relative to the hippopotomus is the whale yet they do not look similar

They are both still unique, both a different species altogether.

I hope you can stay with me as I expand a little on the retrovirus. A retrovirus in a simplistic term inserts a "copy" of it's DNA into it's host (you or me for example). What I mean here is that a section of your DNA is re-written by the virus. Here is a group of DNA letters:

ccctttaaataaattaattttttccccctttccaaatttccccaaaattt aaccccgggcggcaaaa

Let's say for aruement sake we took a very small portion from a specif area of your genome and mine to compare them. We would reasonably expect them to match in this manner

Your DNA

ccctttaaataaattaattttttccccctttccaaatttccccaaaattt aaccccgggcggcaaaa

My DNA

ccctttaaataaattaattttttccccctttccaaatttccccaaaattt aaccccgggcggcaaaa

The result we expect is a match. Now, let us add a retrovirus infects me and misfires and harmlessly inserts it's DNA into me and this little bit of DNA now shows itself in me but not you (since u was not infected). (I have bolded the change) in my DNA caused by the virus

ccctttaaataaattaattttttccccctttccaaatttttagaaaatttaaccccgggcggcaaaa

Now that I have this harmless DNA change in my genome, every child I bring into this world will copy this section of my DNA and every child you bring into the world carries your genome. (also remember your genome right now will not match mine 100%)

Now imagine 10,000 years into the future a modern man wishes to check if he is related to me or to you. And he has this DNA string checked and the result is:

ccctttaaataaattaattttttccccctttccaaatttttagaaaattt aaccccgggcggcaaaa

Based on the result, who is he related to?

I hope that makes sence, cudnt use technical words like you

I hope this makes a little more sense for you to be able to answer the question

[IbnAbdulHakim]

Say i accept what you sed. That we indeed hav those primates insertion in us sumwhere. How comes we are different on so many other levels.

Intelligence,

patience,

looks.

They should have quite a few more similar genes or insertions then just that. Dont you think the change is a bit too vast? or do u think it happened ova such a huge amount of time that the process was completely gradual?

[root]

Say i accept what you sed. That we indeed hav those primates insertion in us sumwhere. How comes we are different on so many other levels.

Goog question

They should have quite a few more similar genes or insertions then just that. Dont you think the change is a bit too vast? or do u think it happened ova such a huge amount of time that the process was completely gradual?

I have bolded what I think is the answer. It's not just a gradual change as it involves a change in actual species, if me and you were to get hold of a time machine and go back a thousand years to pick up our closest ancestor and then move another 1000 years to pick up another closest ancestor and drop off the one we have. If we keep doing this at 1000 year intervals within say 600,000 years you and I would probably not be able to "procreate" with the common ancestor however the common ancestor (the one we keep picking up every 1000) years would still be able to procreate.

Time is a concept man does not really have the ability to grasp. Sure we understand how long a day is, a month or even a year. Perhaps we may be able to understand (just) 100 years, what about 1000. 1 million or even 700million years. For example, if I had a pole of steel in similar shape and size to a pole vaulters pole and once a day I rubbed it once at a specifc end with a silk cloth. How long would it take before the pole has been completely rubbed away by friction?

What about time represented in steps. I live in Scotland, if 1 step represents 1000 years then my first step outside the house takes me to the year 1006, a second step takes me to the birth of christ. To get back in time to our evolutionary beginning I would need to keep walking all the way to london some 500 miles away.

[anis_z24]

Salam,
This is really wierd,
Allah has honered Adam(PBUH) and the his children. So why then do people want to believe that thier origin is from an animal.
question for root.

If I took pieces of a car(expensive and high tech) and left it for a million years, or shook it here and their would it come together? no.
because something needs control the energy.
samething with life.
who controls. if there is no control there is no life.

[HeiGou]

Allah has honered Adam(PBUH) and the his children. So why then do people want to believe that thier origin is from an animal.

I do not think it is a question of wanting to believe anything. It is a question of following the evidence and believing in what science can prove.

If I took pieces of a car(expensive and high tech) and left it for a million years, or shook it here and their would it come together? no.
because something needs control the energy.
samething with life.
who controls. if there is no control there is no life.

Except you are making a wrong comparison. Suppose you did not know anything about how the car worked. But you assembled it to the best of your ability. But every time you put a piece in the wrong place you got an electric shock and every time you got a piece in the right place you got a piece of chocolate. How many millions of years do you think it would take before you put the car back together correctly - even though you knew nothing about how the car was supposed to go?

With evolution it is similar except there is no end goal (a proper car) nor is there such beneign punishments and rewards. If an individual makes a bad choice, they die and hence have few or no children. If they make a good choice, they survive and hence have more children. Instead of electric shocks, you have predators eating you. Instead of chocolate, you have sex. Same principle. You do not need a directing intelligence.

[root]

question for root.

If I took pieces of a car(expensive and high tech) and left it for a million years, or shook it here and their would it come together? no.

Nope. Agreed you are into an eternal loop

because something needs control the energy.

Don't see the relavence. Am I missing something.

samething with life.
who controls. if there is no control there is no life.

I disagree. I take it this (expensive and high tech) "car" would have a nice paint job. If the creator of the car did not exist would the chemical structure of the paint "exist"?

If the creator of "man" never existed, would our chemical structure still exist?

"Answers on a postcard please"

[j4763]

With evolution it is similar except there is no end goal (a proper car) nor is there such beneign punishments and rewards. If an individual makes a bad choice, they die and hence have few or no children. If they make a good choice, they survive and hence have more children. Instead of electric shocks, you have predators eating you. Instead of chocolate, you have sex. Same principle. You do not need a directing intelligence.

And I would imagine that this is the reason that all offspring from a lion and tiger mating are infertile.

[root]

And I would imagine that this is the reason that all offspring from a lion and tiger mating are infertile.

To be honest I don't know much about this issue. I know that when a species is seperated and they evolve indapendantly of each group an important milestone on the way to becoming a seperate species is the inability to interbreed, perhaps lions and tigers are still in the late process of reaching this whilst recognised already as a seperate species.

I would be very very surprised if it never occured that an offspring between the two was done, as it has been in captivity. Perhaps the selection pressures and survivability in the wild is just too much.

Anyways, here is a Ligon (tiger & lion) hybrid:

[Muslim Soldier]

nice pic

[Muhammad Waqqas]

To be honest I don't know much about this issue. I know that when a...

I'm jumping in the discussion so if I miss something, correct me.

Regarding evolution, theory of evolution is already dead. First of all, darwin him self did not agree with his own theory. He clearly started that in his book.

Actually, I would rather want to listen to some logics that an athiest gives for being an athiest. I've talked with several athest, and not a single thing they told me made any logic. I hope you're going to be more logical.

[root]

Regarding evolution, theory of evolution is already dead. First of all, darwin him self did not agree with his own theory. He clearly started that in his book.

And I suppose the Prophet Muhamed did not believe in a God & clearly states that in the Koran.

Actually, I would rather want to listen to some logics that an athiest gives for being an athiest. I've talked with several athest, and not a single thing they told me made any logic. I hope you're going to be more logical.

You don't seem inspire logic yourself currently.

[syilla]

"And I suppose the Prophet Muhamed did not believe in a God & clearly states that in the Koran. " - from root

huh??

can u pls elloborate on this...

[------]

"And I suppose the Prophet Muhamed did not believe in a God & clearly states that in the Koran. "

Excuse me? What do you mean by that root?

[extinction]

And I suppose the Prophet Muhamed did not believe in a God & clearly states that in the Koran.

Sorry you got me confused from your sentence you are implying the Mohammed s.a.w wrote the quraan? Which is false because it is the Word of Allah s.w.t and was bought down by Jibrail A.S and I would very much like to know where in the Quraan such allegations are made....

[HeiGou]

I'm jumping in the discussion so if I miss something, correct me.

Oh so many possible responses, so little bandwidth!

Regarding evolution, theory of evolution is already dead. First of all, darwin him self did not agree with his own theory. He clearly started that in his book.

Where did Darwin clearly state this in his book? The Theory of Evolution must be one of the most thoroughly tested theories in science. People hate it and its implications. And yet it is still clearly the best explanation for how life has developed over time. Why do you think that evolution is not true? And by you I don't mean Harum Yahya or the good Dr Naik.

Actually, I would rather want to listen to some logics that an athiest gives for being an athiest. I've talked with several athest, and not a single thing they told me made any logic. I hope you're going to be more logical.

Well I try my best, but I am not sure the atheist label applies.

[syilla]

i read somewhere....

on this earth...(long time ago) there is other species like human... (i dunno whether we can call it homo sapiens) and it has characteristics like human being...

but that species... they behave like animals... not human... they cannot think...like us...

if the darwin theory is true... why other type of animals do not evolve... and think like the human think...

[HeiGou]

i read somewhere....

on this earth...(long time ago) there is other species like human... (i dunno whether we can call it homo sapiens) and it has characteristics like human being...

but that species... they behave like animals... not human... they cannot think...like us...

Well there are a lot of fossils of proto-humans or members of our family but who were not human. To quote from Wikipedia (of course!)

Homo habilis

H. habilis lived from about 2.4 to 1.5 million years ago (MYA). H. habilis, the first species of the genus Homo, evolved in South and East Africa in the late Pliocene or early Pleistocene, 2.5–2 MYA, when it diverged from the Australopithecines. H. habilis had smaller molars and larger brains than the Australopithecines, and made tools from stone and perhaps animal bones. One of the first known hominids, it was nicknamed 'handy man' by its discoverer, Louis Leakey. Some scientists have proposed moving this species out of Homo and into Australopithecus.
[edit]

Homo rudolfensis and Homo georgicus

These are proposed species names for fossils from about 1.9-1.6 MYA, the relation of which with H. habilis is not yet clear.

* H. rudolfensis refers to a single, incomplete skull from Kenya.
* H.georgicus, from Georgia, may be an intermediate form between H. habilis and H. erectus.

[edit]

Homo ergaster and Homo erectus

The first fossils of Homo erectus were discovered by Dutch physician Eugene Dubois in 1891 on the Indonesian island of Java. He originally gave the material the name Pithecanthropus erectus based on its morphology that he considered to be intermediate between that of humans and apes.

H. erectus lived from about 1.8 MYA to 70,000 years ago. Often the early phase, from 1.8 to 1.25 MYA, is considered to be a separate species, H. ergaster, or it is seen as a subspecies of erectus, Homo erectus ergaster.

In the Early Pleistocene, 1.5–1 MYA, in Africa, Asia, and Europe, presumably, Homo habilis evolved larger brains and made more elaborate stone tools; these differences and others are sufficient for anthropologists to classify them as a new species, H. erectus. In addition H. erectus was the first human ancestor to walk truly upright. This was made possible by the evolution of locking knees and a different location of the foramen magnum (the hole in the skull where the spine enters). They may have used fire to cook their meat.

A famous example of Homo erectus is Peking Man; others were found in Asia (notably in Indonesia), Africa, and Europe. Many paleoanthropologists are now using the term Homo ergaster for the non-Asian forms of this group, and reserving H. erectus only for those fossils found in the Asian region and meeting certain skeletal and dental requirements which differ slightly from ergaster.
[edit]

Homo cepranensis and Homo antecessor

These are proposed as species that may be intermediate between H. erectus and H. heidelbergensis.

* H. cepranensis refers to a single skull cap from Italy, estimated to be about 800,000 years old.
* H. antecessor is known from fossils from Spain and England that are 800,000-500,000 years old.

[edit]

Homo heidelbergensis

H. heidelbergensis (Heidelberg Man) lived from about 800,000 to about 300,000 years ago. Also proposed as Homo sapiens heidelbergensis or Homo sapiens paleohungaricus.
[edit]

Homo neanderthalensis

H. neanderthalensis lived from about 250,000 to 30,000 years ago. Also proposed as Homo sapiens neanderthalensis: there is ongoing debate over whether the 'Neanderthal Man' was a separate species, Homo neanderthalensis, or a subspecies of H. sapiens. While the debate remains unsettled, the prevailing view of evidence, collected by examining mitochondrial DNA and Y-chromosomal DNA, currently indicates that little or no gene flow occurred between H. neanderthalensis and H. sapiens, and, therefore, the two were separate species. In 1997, Dr. Mark Stoneking, then an associate professor of anthropology at Pennsylvania State University, stated: "These results [based on mitochondrial DNA extracted from Neanderthal bone] indicate that Neanderthals did not contribute mitochondrial DNA to modern humans… Neanderthals are not our ancestors." Subsequent investigation of a second source of Neanderthal DNA confirmed these findings. However, supporters of the multiregional hypothesis point to recent studies indicating non-African nuclear DNA heritage dating to one MYA, as well as apparent hybrid fossils found in Portugal and elsewhere, in rebuttal to the prevailing view.
[edit]

Homo rhodesiensis, and the Gawis cranium

* H. rhodesiensis, estimated to be 300,000-125,000 years old, seems to be a mix of H. neanderthalensis, H. heidelbergensis, and H. sapiens: it has been assigned to each of these three species.
* In February 2006 a fossil, the Gawis cranium, was found which is suspected to be a species intermediate between H. erectus and H. sapiens. The skull from Gawis, Ethiopia, is believed to be 500,000-250,000 years old. Only summary details are known. Gawis man used tools and fire, and its facial features suggest its being an intermediate species. So far, it has not yet been named. [1]

[edit]

Homo sapiens

H. sapiens ("sapiens" means wise or intelligent) has lived from about 200 TYA to the present. Between 400,000 years ago and the second interglacial period in the Middle Pleistocene, around 250,000 years ago, the trend in cranial expansion and the elaboration of stone tool technologies developed, providing evidence for a transition from H. erectus to H. sapiens. The direct evidence suggests there was a migration of H. erectus out of Africa, then a further speciation of H. sapiens from H. erectus in Africa (there is little evidence that this speciation occurred elsewhere). Then a subsequent migration within and out of Africa eventually replaced the earlier dispersed H. erectus. However, the current evidence does not preclude multiregional speciation, either. This is a hotly debated area in paleoanthropology.

Current research establishes that human beings are highly genetically homogenous, meaning that the DNA of individual Homo sapiens is more alike than usual for most species, a result of our relatively recent evolution. Distinctive genetic characteristics have arisen however, primarily as the result of small groups of people moving into new environmental circumstances. Such small groups are initially highly inbred, allowing the relatively rapid transmission of traits favorable to the new environment. These adapted traits are a very small component of the Homo sapiens genome and include such outward "racial" characteristics as skin color and nose form in addition to internal characteristics such as the ability to breathe more efficiently in high altitudes.

However there is a lot of debate about how "human" they were. In particular there is a question about Neanderthals. They seem to have buried their dead and mourned them - grave sites have been found. But this is debateable. There is some argument about whether they could talk. They certainly lived in social groups and cared for their young and their old. There is a lot of debate about how far back members of the Homo group used fire and tools and I think it is likely to be before Neanderthals.

if the darwin theory is true... why other type of animals do not evolve... and think like the human think...

You assume we are some perfect evolutionary end goal. We are not. We are what we are. Evolution only looks for what is locally best - a better runner, a better swimmer, a better eater of bananas. It does not look to some "ideal" solution. And we are probably not that ideal anyway. So of course each and every animal evolves for the niche is it in. Why would cows evolve to be smart? They do not need it. It is no use to them. Why would they evolve to walk upright?

All animals evolve. It is just that we have evolved in a niche that rewards walking upright, having little hair and being smart.

[root]

"And I suppose the Prophet Muhamed did not believe in a God & clearly states that in the Koran. " - from root

huh??

can u pls elloborate on this...

"And I suppose the Prophet Muhamed did not believe in a God & clearly states that in the Koran. "


Excuse me? What do you mean by that root?

And I suppose the Prophet Muhamed did not believe in a God & clearly states that in the Koran.

Sorry you got me confused from your sentence you are implying the Mohammed s.a.w wrote the quraan? Which is false because it is the Word of Allah s.w.t and was bought down by Jibrail A.S and I would very much like to know where in the Quraan such allegations are made....

Sorry guys & Gals, I thought posting any old crap as a rubuttle was logic as Muhammad Waqqas displays his thought provoking logical analysis of evolution as noted below:

Muhammad Waqqas
I'm jumping in the discussion so if I miss something, correct me.

Regarding evolution, theory of evolution is already dead. First of all, darwin him self did not agree with his own theory. He clearly started that in his book.

Actually, I would rather want to listen to some logics that an athiest gives for being an athiest. I've talked with several athest, and not a single thing they told me made any logic. I hope you're going to be more logical

.

[czgibson]

Greetings,

I'm jumping in the discussion so if I miss something, correct me.

I think you may find the answers to your questions earlier on in this thread, and in some of the other threads on atheism.

Regarding evolution, theory of evolution is already dead.

What?!

I think the science community should definitely be informed of this!

First of all, darwin him self did not agree with his own theory.

Can you provide any evidence to support this bizarre claim?

He clearly started that in his book.

Yes, he did start his theory in his book. By publishing it, he made the world aware of it.

Actually, I would rather want to listen to some logics that an athiest gives for being an athiest. I've talked with several athest, and not a single thing they told me made any logic. I hope you're going to be more logical.

As I said, you could have a look at this thread or the others on atheism. Another option might be to click on 'Find more posts' from atheists such as root and myself. For the full professional treatment, you could try reading some of the best books there are giving atheist perspectives, such as David Hume's Dialogues Concerning Natural Religion or J. L. Mackie's Miracle of Theism.

Hope that helps.

Peace

[Eric H]

Greetings and peace Muhammad Waqqas;

I've talked with several athest, and not a single thing they told me made any logic.

If you are saying not a single thing atheist say makes sense then maybe you are closing your mind to all forms of reasoning outside Islam.

I feel we have to give our non- believing friends the benefit of the doubt, if there really way proof for the existence of God it would be visible to all believers and we would probably all believe the same.

There would be no Christianity, Islam, Judaism, Hinduism etc. all theists would probably share the same faith.

This conclusive proof does not exist and so we have thousands of logical explanations of what God might be.

In the spirit of searching for God

Eric

[Link]

I feel we have to give our non- believing friends the benefit of the doubt, if there really way proof for the existence of God it would be visible to all believers and we would probably all believe the same.

There would be no Christianity, Islam, Judaism, Hinduism etc. all theists would probably share the same faith.

This conclusive proof does not exist and so we have thousands of logical explanations of what God might be.

There is proof of God, it is intuitive logic, however athiest accept the intuitive logic to all things except the origin of the universe, when then all of a sudden, it just flies out the window for them

not all thiest search for the truth, all those who search for truth find it, because intuitive logic is in all of us

There is conclusive proof, however if you depend on non-logic, like all your statements are, then ofcourse, you can't get to that proof

[root]

There is proof of God,

More unsubstantiated claims.

it is intuitive logic, however athiest accept the intuitive logic to all things except the origin of the universe, when then all of a sudden, it just flies out the window for them

Sorry, I kust fail to to see how the origin of the universe either disproves or proves either side since the origin is still a great scientific mystery.

[czgibson]

Greetings,

There is proof of God, it is intuitive logic, however athiest accept the intuitive logic to all things except the origin of the universe, when then all of a sudden, it just flies out the window for them

Where does this idea come from, that the existence of god has been proven? I see it again and again on this forum, yet anyone who gave this claim the slightest consideration would know that if it were true, then everyone would believe in god, just as everyone believes in Pythagoras' theorem.

Also, the origin of the universe is a difficult matter to consider under the rules of logic, since we have no information about it. Therefore it is not possible to apply logic to it.

There is conclusive proof, however if you depend on non-logic, like all your statements are, then ofcourse, you can't get to that proof

Whose statements consist of non-logic? Are you using a different definition of logic than the rest of the world?

Peace

[Link]

Therefore it is not possible to apply logic to it.

This the problem right there, the same logic we all universally agree upon is out of the window when discussing origin of the universe

You don't want to apply logic to it, but if you apply logic to it, the truth is apparent

[root]

Coming back to the nonsense of this point:

it is intuitive logic, however athiest accept the intuitive logic to all things except the origin of the universe, when then all of a sudden, it just flies out the window for them

Sorry to go over it again, but I thought new information may help shed light on the dangers of absolute truth for something we do not yet understand. Only a fool would claim "absolute truth" to questions as big as the one you seem to answer with an uneasy ease

A joint UK-US team has put forward an alternative theory of cosmic evolution.

It proposes that the Universe undergoes cycles of "Big Bangs" and "Big Crunches", meaning our Universe is merely a "child of the previous one".

It challenges the conventional view of the cosmos, which observations show to be 12-14 billion years old.

The new ideas, reported in the journal Science, may explain why the expansion of the Universe is accelerating, the researchers say.

"At present the conventional view is that all of space, time, matter and energy began at a single point, which then expanded and cooled, leaving the Universe as it is today," said Professor Paul Steinhardt of Princeton University, New Jersey.

"However, this new theory suggests that there's a continuous cycle of universes, with each a repeat of the last, but not an exact replica.

"It can be thought of as a child of the previous universe."

A dark matter parallel universe may exist

"The explanation as to why this constant is so small has become one of the biggest problems in physics.

"At present, the only explanation for this is that things just have to be that way." This theory leaves many questions unanswered, but now Professors Steinhardt and Turok have developed a new theory to explain why the cosmological constant is so small.

They suggest that time actually began before the Big Bang, meaning there was a pre-existing universe.

This would also mean that the current Universe is much older than presently accepted.

Dark matter

"At present there may be an alternative 'dark matter' universe that exists at the same time as ours, but we could never reach it," explained Professor Turok.

"The best way to think of this is to think of a pane of double glazing with a fly on it. The fly is unable to cross over from one side to another, just like we are unable to get from one universe to another.

"These two universes are drawn together by the force of gravity and will eventually collide.

"This means that things that are happening now will help to create another universe in the future."

Source:http://news.bbc.co.uk/1/hi/sci/tech/4974134.stm
Last Updated: Friday, 5 May 2006, 16:24 GMT 17:24 UK

[Link]

you can further the cause and effect as back as you want with a billion previous universes if you want, the concept is still there however, so it doesn't matter

btw-define 'Time'

[root]

you can further the cause and effect as back as you want with a billion previous universes if you want,

Correct.

the concept is still there however, so it doesn't matter

But with an infinate number of universes you then get an infinate number of variation (mass etc etc) which gives you the "chance" to hit the "just right" spot for a stable universe as opposed to one universe one chance to get it right!

Which leads me onto my next point, i always have difficulty understanding why religous doctrine always tries to paint our earth and Humans as a "special creation". Not only do we find a truly astounding number of suns and orbiting planets in the universe I(afterall thier are more suns than grains of sand on the earth) and most suns will have planets orbiting them. Why make billions and billions of planets and consider "earth" special. Indeed, why create billions of universes which probably contain an infinate number of stars and planets like our own universe. Surely, a car manufacturer does not make a trillion cars for every car he actually uses and sells? where is the logic

btw-define 'Time'

Time is a concept album by Electric Light Orchestra. It was released in 1981 (see 1981 in music). In 2001 it was reissued with three additional tracks that were B-sides of singles from the original album.

[czgibson]

Greetings,

This the problem right there, the same logic we all universally agree upon is out of the window when discussing origin of the universe

You don't want to apply logic to it, but if you apply logic to it, the truth is apparent

OK, since you obviously don't even have the first clue what logic actually is, let's leave it there.

In the meantime, can I recommend this page as an introduction?

Peace

[syilla]

You assume we are some perfect evolutionary end goal. We are not. We are what we are. Evolution only looks for what is locally best - a better runner, a better swimmer, a better eater of bananas. It does not look to some "ideal" solution. And we are probably not that ideal anyway. So of course each and every animal evolves for the niche is it in. Why would cows evolve to be smart? They do not need it. It is no use to them. Why would they evolve to walk upright?

All animals evolve. It is just that we have evolved in a niche that rewards walking upright, having little hair and being smart.

are u saying human being is not special...??

are you saying we also behave like all the animals in this world....

can u pls explain this...

[syilla]

i know the animals evolve... i just want to know why they do not think like we think... i mean in the sense of act based on feeling, having to analyze and having a critical thinking...

i know some of the human act like animals...but i'm not talking about them...

i want an answer and prove saying that human is not unique and human that try his best to be compassionate, not being hyprocrites..., not acting on impulse...and etc are not better than animals...

[HeiGou]

are u saying human being is not special...??

Not in the sense you mean.

are you saying we also behave like all the animals in this world....

We eat, drink, sleep, have sex, enjoy our children, live in groups. In many ways we are like other animals in this world - especially our near relatives. Does that bother you?

[HeiGou]

i know the animals evolve... i just want to know why they do not think like we think... i mean in the sense of act based on feeling, having to analyze and having a critical thinking...

It is not locally useful. It is no benefit for a cow to think critically. And it costs a lot of energy. A dumb cow is a better cow. The question is why can we and that does seem unusual.

i want an answer and prove saying that human is not unique and human that try his best to be compassionate, not being hyprocrites..., not acting on impulse...and etc are not better than animals...

I think that only humans are hypocrits because only humans think about it. Wolves do what they do with no shame at all. Not all animals act on impluse. I do not think that humans are unique except in so far as we have some characteristics shared by many others and take them to extremes.

[master_seth]

ok ok ok brother, wen u say u dnt believe in god, wat u mean by god?

[Muhammad]

Hello Callum,

Where does this idea come from, that the existence of god has been proven? I see it again and again on this forum, yet anyone who gave this claim the slightest consideration would know that if it were true, then everyone would believe in god, just as everyone believes in Pythagoras' theorem.

Perhaps it is your idea of 'proof' which renders this idea invalid, when in fact it is not so impossible as it may seem. Perhaps you are waiting for it to be written in a scientific journal that 'God has been discovered', where it is hoped that somebody might see Him, or sense Him physically in some way. Yet if that were the case, we might then be asked to question our concept of God, given that:

6:103 No vision can grasp Him, but His grasp is over all vision: He is above all comprehension, yet is acquainted with all things.

And that the purpose of life is a test through which some succeed and some fail. If the answers to a test are made available before its completion, the test is pointless. Similarly, if we were all living with God in heaven, there would not be much to test.

Having said this, it is not the case that we are left in darkness to find our own truth. God has created many signs and evidences that point to His existence; it is up to the individual to study and ponder over them.

You mentioned that "everyone believes in Pythagoras' Theorem". Pythagoras' Theorem is a rule; a means by which we can find an answer. It is not a physical entity or a being of some kind. So in the same way that we use a mathematic equation to find an answer, we can apply our intellect to the world in order to find our answer about God.

All in all, there is proof; perhaps in a different format to how you imagined.

[6.109] And they swear by Allah with the strongest of their oaths, that if a sign came to them they would most certainly believe in it. Say: Signs are only with Allah; and what should make you know that when it comes they will not believe?

Peace.

[czgibson]

Greetings,

Perhaps it is your idea of 'proof' which renders this idea invalid, when in fact it is not so impossible as it may seem.

I'm using the idea in the sense of logic, law or mathematics. In what sense are you using the term?

And that the purpose of life is a test through which some succeed and some fail. If the answers to a test are made available before its completion, the test is pointless. Similarly, if we were all living with God in heaven, there would not be much to test.

Having said this, it is not the case that we are left in darkness to find our own truth. God has created many signs and evidences that point to His existence; it is up to the individual to study and ponder over them.

What does any of this have to do with proof?

You mentioned that "everyone believes in Pythagoras' Theorem". Pythagoras' Theorem is a rule; a means by which we can find an answer. It is not a physical entity or a being of some kind. So in the same way that we use a mathematic equation to find an answer, we can apply our intellect to the world in order to find our answer about God.

Pythagoras' Theorem has been proven. It yields true answers. Applying our intellect to the world may yield all sorts of answers - some of them sensible, some of them crazy. In what sense would you consider this process to be any kind of proof on the order of the proof of Pythagoras' Theorem?

All in all, there is proof; perhaps in a different format to how you imagined.

Well, people are obviously free to use words in any way they want - however, I'll continue to use the word 'proof' under its standard dictionary definitions. What meaning do you attach to the term, since it's one I'm obviously unfamiliar with?

I'll say it again - if there actually were proof that god existed, then everyone would believe it. It's as simple as that.

Peace

[Link]

There are basically four logical approaches we believe logical conclusively prove the existence of God

1) The concept of infinity with the rule "from nothing, nothing follows"
2) Cause and effect, (initiated needed a iniator, movement needs a cause, and everything in science is explained with this rule)
3) Critical look at what consitutes substance (table made out of wood, wood made out of ___ which is made out of ___, and on and on and the limits of our fives sense)
4) The design perspective and the fact cayause does not bring order and design

These things have been discussed in detail, I can do discuss here also but first I need to know

Do you two athiests want to believe in God or not?

[czgibson]

Greetings,

There are basically four logical approaches we believe logical conclusively prove the existence of God

Logic has nothing whatsoever to do with belief. You can't say that you believe something logically proves something else - either it does or it doesn't.

1) The concept of infinity with the rule "from nothing, nothing follows"

So how was god created then - or is god an exception to this?

2) Cause and effect, (initiated needed a iniator, movement needs a cause, and everything in science is explained with this rule)

The cosmological argument - basically a rephrasing of your first one if I understand you correctly.

3) Critical look at what consitutes substance (table made out of wood, wood made out of ___ which is made out of ___, and on and on and the limits of our fives sense)

Could you explain this one a bit more - I don't recognise this argument.

4) The design perspective and the fact cayause does not bring order and design

The argument from design, which, as you say, has been discussed many times before. The basic objection to it is to ask why god designed us with blind spots in our eyes and other suboptimal features.

These things have been discussed in detail, I can do discuss here also but first I need to know

Do you two athiests want to believe in God or not?

Speaking for myself, I think it would be quite comforting to believe in god - it's just that I see no reason to do so.

Also, don't tell me you just believe in god because you want to? :confused:

Peace

[Muhammad]

Greetings,

I'm using the idea in the sense of logic, law or mathematics. In what sense are you using the term?

I'm using the term in quite a general way, since 'proof' is not limited to a specific field such as mathematics or science.

What does any of this have to do with proof?

It is explaining my initial statement that proof does not have to constitute statements made by the scientific community.

Applying our intellect to the world may yield all sorts of answers - some of them sensible, some of them crazy. In what sense would you consider this process to be any kind of proof on the order of the proof of Pythagoras' Theorem?

Pythagoras' Theorem can yield wrong answers if used incorrectly or without proper understanding. By analogy, our intellects will similarly yield insensible answers if used incorrectly. Furthermore, it may not be so much the process that is a proof, but rather the reasoning determined by it.

Well, people are obviously free to use words in any way they want - however, I'll continue to use the word 'proof' under its standard dictionary definitions. What meaning do you attach to the term, since it's one I'm obviously unfamiliar with?

I think the meaning is pretty much the same as yours. Where do you feel that it isn't?

I'll say it again - if there actually were proof that god existed, then everyone would believe it. It's as simple as that.

I don't think it's that simple, as I tried to explain with the concept of life being a test. The very definition of faith teaches us that belief does not rest solely upon material evidence.

Peace :)

[czgibson]

Greetings Muhammad,

I'm using the term in quite a general way, since 'proof' is not limited to a specific field such as mathematics or science.

True, it isn't, but when we're talking about any kind of truth, our use of the word 'proof' must always derive ultimately from logic, wouldn't you agree?

It is explaining my initial statement that proof does not have to constitute statements made by the scientific community.

OK, but I have never said that that was the case.

Pythagoras' Theorem can yield wrong answers if used incorrectly or without proper understanding. By analogy, our intellects will similarly yield insensible answers if used incorrectly. Furthermore, it may not be so much the process that is a proof, but rather the reasoning determined by it.

This is a fair analogy, and you're right that the process itself doesn't constitute a proof, just as using Pythagoras' Theorem is not the same as proving it. I think my original point remains, though: Pythagoras' Theorem has been proven; everyone believes it (if 'believe' is the right word). You claim there is proof that god exists; why then, is not every person on the planet a theist?

I think the meaning is pretty much the same as yours. Where do you feel that it isn't?

Let's look at the primary definition of 'proof' as given by dictionary.com. (Subsequent definitions follow from this one, and I've also excluded meanings which are obviously not related to our discussion, such as the measure of alcoholic strength etc.):

The evidence or argument that compels the mind to accept an assertion as true.

There are two parts to this that I'd like to focus on. First of all, 'compels'. The mind is forced to accept something as being true due to evidence or argument. This means that no other explanation is possible.

With the existence of god question, other explanations are possible, such as the idea that the idea of god is a creation originating in the human mind. Also, it is clear that not everyone feels compelled by evidence or argument to believe in god.

Secondly, we have the phrase 'the mind'. This refers to anyone's mind, not yours, mine or somebody else's in particular. Therefore a proof must be convincing to any mind, not just one that accepts the result already.

For the purposes of our discussion, the proof of Pythagoras' Theorem satisfies these criteria in a way that proofs of the existence of god do not.

I don't think it's that simple, as I tried to explain with the concept of life being a test. The very definition of faith teaches us that belief does not rest solely upon material evidence.

Of course - but the proof of Pythagoras' Theorem does not rely on material evidence either. It is an abstract operation, like an argument for the existence of god. The difference is that one of these is classified as a proof, and the other is not - except, it seems, among Muslims.

Peace

[Muhammad]

Greetings Callum,

True, it isn't, but when we're talking about any kind of truth, our use of the word 'proof' must always derive ultimately from logic, wouldn't you agree?

Yes, I don't see a problem with that, since logic can be applied to pretty much anything.

With the existence of god question, other explanations are possible, such as the idea that the idea of god is a creation originating in the human mind. Also, it is clear that not everyone feels compelled by evidence or argument to believe in god.

Firstly, not everyone undertakes the search for God with the same level of scrutiny and sincerity as others. Not everyone bothers to find out about these things in the first place, so in this way, many people do not believe in God upon grounds that don't have anything to do with proof. Similarly, there are probably people in the world who don't know what Pythagoras' Theorem is, yet that is not because they see proof for its invalidity but more so because of their ignorance.

As for the evidence for the existence of God, then at first it might seem like there could be various possibilities, just like there could be for finding the third side of a triangle had Pythagoras' Theorem not been discovered. Upon examining the evidience though, other possibilities are ruled out and a final conclusion can be drawn.

There is also another factor that comes to mind, explaining why not everyone shares the same belief in God, and that is denial. For some who realise that there is a God, and understand the evidence that points to Him, desire and personal aims hold them back. Perhaps it is upholding a family tradition or fear of surrounding reaction; many things such as this act to create denial in people's hearts. Ultimately, guidance is from God Himself and we can only pray for the misguided.

Secondly, we have the phrase 'the mind'. This refers to anyone's mind, not yours, mine or somebody else's in particular. Therefore a proof must be convincing to any mind, not just one that accepts the result already.

I agree.

For the purposes of our discussion, the proof of Pythagoras' Theorem satisfies these criteria in a way that proofs of the existence of god do not.

However, we have not begun to consider what the proofs of the existence of God are, so we cannot really compare them to Pythagoras' Theorem. Furthermore, this likening of the proofs of God's existence to science/mathematics relates back to my point that such a comparison isn't always necessary. For example, Pythagoras' Theorem is like a rule by which this universe is governed, like gravity. If we look at how these rules came about and ponder over their regulation, we are viewing the matter in a different way while still using logic and open to being compelled to accept a true answer.

Peace :)

[shaharoun]

:sl:
What is to prove by the way?
If you prove the abiklity of the creator,
does it not enough to prove the existance of God?
Whom one can deny the existance of God?
I'm sure even those who are still believing there is no God,still they have a lot of doubts in their faith.
Think about the God's creation then you will be clear on His existancer if God

[Muhammad Waqqas]

Greetings,


I think you may find the answers to your questions earlier on in this thread, and in some of the other threads on atheism.

Thanks for telling me that I can find answers to my question in earlier pages, that was a really strange thing, I was shocked to read that.

What?!

I think the science community should definitely be informed of this!

Can you provide any evidence to support this bizarre claim?

Yes, he did start his theory in his book. By publishing it, he made the world aware of it.

As I said, you could have a look at this thread or the others on atheism. Another option might be to click on 'Find more posts' from atheists such as root and myself. For the full professional treatment, you could try reading some of the best books there are giving atheist perspectives, such as David Hume's Dialogues Concerning Natural Religion or J. L. Mackie's Miracle of Theism.

Hope that helps.

Peace

Are these things worth discussing?!? Are they!??
They are not!

Next, these athiests start speaking about wanting to believe in God blah blah.. Is that worth talking about?? What's the actual topic we are talking about here? The main thing we need to discuss is "Darwin HIM SELF DID NOT BELIEVE IN HIS OWN THEORY!" Then why the heck is everybody else so blind?!?

Point # 1: I'm quoting now, you can chekup with the book:

Origion of Species, Ch 6 (Diffulcities on Theory), Paragraph 3: "...the following heads:- Firstly, why, if species
have descended from other species by insensibly fine gradations, do we not everywhere see
innumerable transitional forms?"

Point # 2: I'm quoting now, you can chekup with the book:

Origion of Species, Ch 6 (Diffulcities on Theory), Paragraph 3: "Why is not all nature in confusion instead of the species being, as
we see them, well defined?"

Point # 3: I'm quoting now, you can chekup with the book:

Origion of Species, Ch 6 (Diffulcities on Theory), Paragraph 4: "Secondly, is it possible that an animal having, for instance, the structure and habits of a bat, could
have been formed by the modification of some animal with wholly different habits? Can we
believe that natural selection could produce, on the one hand, organs of trifling importance, such as
the tail of a giraffe, which serves as a fly-flapper, and, on the other hand, organs of such wonderful
structure, as the eye, of which we hardly as yet fully understand the inimitable perfection?"

Point # 4: I'm quoting now, you can chekup with the book:

Origion of Species, Ch 6 (Diffulcities on Theory), Paragraph 6: "Fourthly, how can we account for species, when crossed, being sterile and producing sterile
offspring, whereas, when varieties are crossed, their fertility is unimpaired?"

Atleast READ THE WHOLE BOOK? If you cannot, ATLEAST READ THE WHOLE CHAPTER?

root kept talking about: logic.. etc. what ever that was, Is that all logical?

Will you believe that which root is writing here on the forum, or that which Darwin HIM SELF wrote in the book which is for sale out there at a very low price, WHICH ONE WILL YOU BELIEVE?!?

The time in which darwin was living, people used to believe in things like "Living born out of dead" (Spontaneous Generation) because they thought that when rotten meat is left alone, some small germs are born over it bla bla, that's why living beings can get life from dead.

If you just read the 6th chapter of Darwin's book "The Origin of Species" you'll realize everything he said was nothing.

Before darwin, atheist were there, but when he wrote a book, they found a way out, and started to believe this theory comletly unconditionally. Reason? "They are afraid, that if somebody proves to them the existance of God, the'll have to obey God's orders."

What they fail to realize is, that If suppose God dosen't exist, then people who believe in God will too become sand with the athiests, but what if God existed? Where will the Athiests go then? There will be no way back to earth. Just on a blind assumption, are you going to risk you whole life of etternity?

Allah promises that if you follow his commandments complely, he'll give you a happy life here, as well as in the hereafter, this is what keeps me connected to Islam. Because Alhamdulilah, before following Islam, I had no connection with peace of Mind, and Now I have, its hardly a year now.

Darwin thought that the new scientific research will help confirm his theory, but it did exactly the opposite:

1. His thory dosen't speak anything about how life "STARTED", it dose talk about its transformation, but nowhere in his book he wrote any logical reson of how the life "STARTED" on earth.

2. There is not a single scientific research which has proved that the self-existant machanism can give birth to Life.

3. The fossils that the Geologists have found are "SHOUTING" that this theory is completly incorrect. (Reffer to the post below)

The first point says that about sevral billion years ago, there was a single cell, which gave rise to humans etc. Therefore, where when and who took the first and foremost step?

This theory says that Inanimate Matter just coninsidently give birth to the first animal on the planet.

Imagin.. coninsidently.. All humans, trees are formed. Humans and trees have nothing in common at all. Yet, they are transformed form of one Another..

After 5 years of Darwin's book, Louis Pasteur's research completely disregarded the theory of Evolution, in his book he mentioned that "The Idea that living things take birth from non-living is burried for ever in the graveyard of the History."

I can write another book on this topic, if everybody is willing to read and reply, but with LOGIC, not that "I dont want to do that..", "I want to do that.."

No body cares what you want to do and what you don't want to do, comeup with a logic.

[Muhammad Waqqas]

The Cœlacanth: An Example of a False Intermediate Form

1.

A 410-million-year-old Cœlacanth fossil.

2.

Another living Cœlacanth specimen.

3.

The tail of the living Cœlacanth and that of a 140-million-year-old fossil specimen are identical to one another.

The Horseshoe Crab

4.

Horseshoe crab. A 450-million-year-old horseshoe crab is no different to specimens alive today. It has possessed the same complex features and equipment for the last half billion years or so. Clearly, at a time when—according to Darwinists—living things should have been evolving, no evolution actually took place.


The Cockroach

5.

A 300-million-year-old cockroach, with exactly the same features as cockroaches today. This fossil, which lived 300 million years ago, definitively refutes Darwin's theory of evolution.

Source:

1. Keith S. Thomson, Living Fossil: The Story of the Coelacanth, 1991, book cover

2. "Evolution:Living Fossils," http://www.straight-talk.net/evolution/living.htm

3. Jean-Jacques Hublin, The Hamlyn Encyclopædia of Prehistoric Animals, New York: The Hamlyn Publishing Group Ltd., 1984, p. 120

4. Don Knapp, "New sighting of 'living fossil' intrigues scientists," CNN.com, 23 September 1998, http://edition.cnn.com/TECH/science/9809/2...ssil/index.html

5. "Evolution:Living Fossils," http://www.straight-talk.net/evolution/living.htm

6. Wesson, Beyond Natural Selection, 1991, MIT Press: Cambridge MA, 1994, reprint, pp. 207-208

It is clear, very vivid, that Darwin's Theory is DEAD.

[syilla]

Hei Go...

If you're saying human is not unique... then why human are always not satisfy and always want to change or improve their quality of life...

don't u think that... the animals, plants and the earth... can live happily together in harmony and everything will always in order. I'm sure they do not need this so call 'human being'.

but why this so call 'human being' is on this earth destroying everything... especially the earth... don't u think 'that' make human as a unique living creatures....

I'm sad... if u think that human... is just like animals...
then if human is like animals... they will never have purpose living in this earth... . When they do not have purpose in this life... they will act like animals... and of course they will destroy the earth...(as what u have said...eat, sleep and enjoy life - i don't need to be better than the animals).

IMHO, if a human think they are like animals... do not buy car... do not buy bungalows or any type of houses or do not buy computer.... they should try living like the animals... in the jungle or in the dessert. Do not try anything to improve their quality ways of life.... just live like a tarzan... If not then they are hyprocrites.(That's why religion teach us do not to be hyprocrites...)

IMHO, i believed... human is unique... human is put on this earth to be tested.

[Muhammad Waqqas]

Hei Go...

If you're saying human is not unique... then why human are always not satisfy and always want to change o...

Syilla, we are getting your point. But lets be silent and wait for a reply from their side.

[Muhammad Waqqas]

I would request my athiesm-supporting brothers to post a brief, and "TO THE POINT" reply.

No body will read a tale of 5 generations if you posted the way you are doing it in previous posts. Be brief, to the point, and logical.

[HeiGou]

If you're saying human is not unique... then why human are always not satisfy and always want to change or improve their quality of life...

And ants don't?

don't u think that... the animals, plants and the earth... can live happily together in harmony and everything will always in order. I'm sure they do not need this so call 'human being'.

I do not know what you mean by harmony. Even if there were no people around I would not lie down and sleep with a lion if I were a lamb. I do think that the world could get by nicely without us.

but why this so call 'human being' is on this earth destroying everything... especially the earth... don't u think 'that' make human as a unique living creatures....

Well unique in the sense that we have built tools that enable us to do so. But I doubt that wolves would be any better if they had AK-47s. I have seen what foxes do to chickens after all.

I'm sad... if u think that human... is just like animals...
then if human is like animals... they will never have purpose living in this earth... . When they do not have purpose in this life... they will act like animals... and of course they will destroy the earth...(as what u have said...eat, sleep and enjoy life - i don't need to be better than the animals).

I think we have a purpose, but not one that is written in our biology or DNA. We are here to be good to each other and make the world a better place. Biology is not destiny! We do not have to "live like animals" as you put it if we do not want to because we are also aware of who and what we are and we can make good choices as well as bad.

Why do you think that we will destroy the Earth if we think we are like animals? Surely most environmental damage is done by Believers and the ignorant (not always the same groups)?

IMHO, if a human think they are like animals... do not buy car... do not buy bungalows or any type of houses or do not buy computer.... they should try living like the animals... in the jungle or in the dessert. Do not try anything to improve their quality ways of life.... just live like a tarzan... If not then they are hyprocrites.(That's why religion teach us do not to be hyprocrites...)

Why is it hypocritical to live like modern humans if I happen to think that we are animals like other animals (although I do not exactly)? Surely that is like saying Muslims are hypocrits for buying cars and computers when of course Muhammed never had one and hence it must be Bida? Who thinks that?

IMHO, i believed... human is unique... human is put on this earth to be tested.

Well fossils are quite a test - how else do you explain them?

[HeiGou]

Thanks for telling me that I can find answers to my question in earlier pages, that was a really strange thing, I was shocked to read that.

So can I save us all a lot of time and ask which Muslim apologetics site you cribbed this from?

Next, these athiests start speaking about wanting to believe in God blah blah.. Is that worth talking about?? What's the actual topic we are talking about here? The main thing we need to discuss is "Darwin HIM SELF DID NOT BELIEVE IN HIS OWN THEORY!" Then why the heck is everybody else so blind?!?

What makes you think that Darwin did not believe his own theory and if he did not, why did he spend so much time defending it?

Point # 1: I'm quoting now, you can chekup with the book:

Origion of Species, Ch 6 (Diffulcities on Theory), Paragraph 3: "...the following heads:- Firstly, why, if species
have descended from other species by insensibly fine gradations, do we not everywhere see innumerable transitional forms?"

Because we do.

Point # 2: I'm quoting now, you can chekup with the book:

Origion of Species, Ch 6 (Diffulcities on Theory), Paragraph 3: "Why is not all nature in confusion instead of the species being, as we see them, well defined?"

Definition of species is a social construct. There is no real distinction between things being in confusion and things being well defined. Besides one of the assumptions is Deep Time - life has been around for a long long time. So species change slowly over thousands of years - of course a short term focus sees good definition even though in the scale of millenia it is all change.

Point # 3:I'm quoting now, you can chekup with the book:

Origion of Species, Ch 6 (Diffulcities on Theory), Paragraph 4: "Secondly, is it possible that an animal having, for instance, the structure and habits of a bat, could have been formed by the modification of some animal with wholly different habits? Can we
believe that natural selection could produce, on the one hand, organs of trifling importance, such as the tail of a giraffe, which serves as a fly-flapper, and, on the other hand, organs of such wonderful structure, as the eye, of which we hardly as yet fully understand the inimitable perfection?"

Well yes it is possible as Darwin agreed. And as study of the eye shows, it proves evolution because it is not a wonderful structure but a messy, poorly designed organ that clearly evolved.

Point # 4: I'm quoting now, you can chekup with the book:

Origion of Species, Ch 6 (Diffulcities on Theory), Paragraph 6: "Fourthly, how can we account for species, when crossed, being sterile and producing sterile offspring, whereas, when varieties are crossed, their fertility is unimpaired?"

Because a species is usually defined as that which produces sterile offspring if at all. This is obviiously proof of evolution - if two species could interbreed they would be one species.

Atleast READ THE WHOLE BOOK? If you cannot, ATLEAST READ THE WHOLE CHAPTER?

Please do.

The time in which darwin was living, people used to believe in things like "Living born out of dead" (Spontaneous Generation) because they thought that when rotten meat is left alone, some small germs are born over it bla bla, that's why living beings can get life from dead.

Umm, not by Darwin's time they did not.

If you just read the 6th chapter of Darwin's book "The Origin of Species" you'll realize everything he said was nothing.

Why do you think anything so silly?

Before darwin, atheist were there, but when he wrote a book, they found a way out, and started to believe this theory comletly unconditionally. Reason? "They are afraid, that if somebody proves to them the existance of God, the'll have to obey God's orders."

And how do you explain the existence of religiously observant Christian, Jewish and even Muslim biologists who accept God and Darwin's theory?

Why would people be afraid of obeying God anyway? It is not as if Islam is a difficult religion!

Darwin thought that the new scientific research will help confirm his theory, but it did exactly the opposite:

1. His thory dosen't speak anything about how life "STARTED", it dose talk about its transformation, but nowhere in his book he wrote any logical reson of how the life "STARTED" on earth.

And yet scientific experiments since have shown precisely how life could have started. Btu I agree his theory does not talk about how life started.

2. There is not a single scientific research which has proved that the self-existant machanism can give birth to Life.

Which is not true. Look up the Miller Experiment

The Miller-Urey experiment (or Urey-Miller experiment) was an experiment that simulated hypothetical conditions present on the early Earth and tested for the occurrence of chemical evolution (the Oparin and Haldane hypothesis stated that conditions on the primitive Earth favored chemical reactions that synthesized organic compounds from inorganic precursors; the Miller-Urey tested this hypothesis). The experiment is considered to be the classic experiment on the origin of life. It was conducted in 1953 by Stanley L. Miller and Harold C. Urey at the University of Chicago.

3. The fossils that the Geologists have found are "SHOUTING" that this theory is completly incorrect. (Reffer to the post below)

Actually they shout precisely the opposite.

After 5 years of Darwin's book, Louis Pasteur's research completely disregarded the theory of Evolution, in his book he mentioned that "The Idea that living things take birth from non-living is burried for ever in the graveyard of the History."

How does Pasteur's work relate to Darwin's?

[HeiGou]

It is clear, very vivid, that Darwin's Theory is DEAD.[/I]

Is this the best you can come up with? Darwin does not say that animals have to evolve and change. It is not complusory. If they find a small and uncompetitive niche, or they arrive at a form that is well adapted to their way of life, it is entirely possible that they will remain as they are for a long time. That does not disprove evolution. After all what is the alternative? That God did such good work on cockroaches that He left the design alone for 300 million years, but He did not like Hummingbirds so He has kept fiddling with their design? I mean, the idea is absurd. This does not even begin to disprove evolution although all the other species which are not 300 million years old strike a blow against the idea that God created life without evolution.

[IceQueen~]

did you know that darwin believed in God?:)

[IceQueen~]

i do RE and the other thing is, our teacher always tells us not to say ''darwin believed blaa blaa..'' because he did NOT believe his theory of evolution, but others took his theory and developed views from it!

[------]

But whats the point of developing the theory then?! :heated:

[root]

Point # 1: I'm quoting now, you can chekup with the book:

Origion of Species, Ch 6 (Diffulcities on Theory), Paragraph 3: "...the following heads:- Firstly, why, if species have descended from other species by insensibly fine gradations, do we not everywhere see innumerable transitional forms?"

Point # 2: I'm quoting now, you can chekup with the book:

Origion of Species, Ch 6 (Diffulcities on Theory), Paragraph 3: "Why is not all nature in confusion instead of the species being, as we see them, well defined?"

Point # 3: I'm quoting now, you can chekup with the book:

Origion of Species, Ch 6 (Diffulcities on Theory), Paragraph 4: "Secondly, is it possible that an animal having, for instance, the structure and habits of a bat, could have been formed by the modification of some animal with wholly different habits? Can we believe that natural selection could produce, on the one hand, organs of trifling importance, such as the tail of a giraffe, which serves as a fly-flapper, and, on the other hand, organs of such wonderful
structure, as the eye, of which we hardly as yet fully understand the inimitable perfection?"

And then darwin went on to say:

The two first heads shall be here discussed Instinct and Hybridism in separate chapters.

On the absence or rarity of transitional varieties. As natural selection acts solely by the preservation of profitable modifications, each new form will tend in a fully-stocked country to take the place of, and finally to exterminate, its own less improved parent or other less-favoured forms with which it comes into competition. Thus extinction and natural selection will, as we have seen, go hand in hand. Hence, if we look at each species as descended from some other unknown form, both the parent and all the transitional varieties will generally have been exterminated by the very process of formation and perfection of the new form.

But, as by this theory innumerable transitional forms must have existed, why do we not find them embedded in countless numbers in the crust of the earth? It will be much more convenient to discuss this question in the chapter on the Imperfection of the geological record; and I will here only state that I believe the answer mainly lies in the record being incomparably less perfect than is generally supposed; the imperfection of the record being chiefly due to organic beings not inhabiting profound depths of the sea, and to their remains being embedded and preserved to a future age only in masses of sediment sufficiently thick and extensive to withstand an enormous amount of future degradation; and such fossiliferous masses can be accumulated only where much sediment is deposited on the shallow bed of the sea, whilst it slowly subsides. These contingencies will concur only rarely, and after enormously long intervals. Whilst the bed of the sea is stationary or is rising, or when very little sediment is being deposited, there will be blanks in our geological history. The crust of the earth is a vast museum; but the natural collections have been made only at intervals of time immensely remote.

Point # 4: I'm quoting now, you can chekup with the book:

Origion of Species, Ch 6 (Diffulcities on Theory), Paragraph 6: "Fourthly, how can we account for species, when crossed, being sterile and producing sterile
offspring, whereas, when varieties are crossed, their fertility is unimpaired?"

To be honest I think you should have taken the advice of the author of the below words because I think you have done a "cut n paste job" without considering what you are indeed saying. All you have done here is to show deciet. Within the origin of species (Chapter 6) Darwin begins by presenting criticism for his own theory then goes onto answering this criticism. By simply presenting the criticism and then neglecting Darwins answers to his criticism is misleading to say the least.

Atleast READ THE WHOLE BOOK? If you cannot, ATLEAST READ THE WHOLE CHAPTER?

Why don't you take the advice of the original author of your words. here is the chapter in full:

http://www.literature.org/authors/da...hapter-06.html

root kept talking about: logic.. etc. what ever that was, Is that all logical?

Will you believe that which root is writing here on the forum, or that which Darwin HIM SELF wrote in the book which is for sale out there at a very low price, WHICH ONE WILL YOU BELIEVE?!?

Do you think the validity of a book be judged by it's price?

The time in which darwin was living, people used to believe in things like "Living born out of dead" (Spontaneous Generation) because they thought that when rotten meat is left alone, some small germs are born over it bla bla, that's why living beings can get life from dead.

I agree, Darwins theory was a major change from accepted mainstream thoughts accounting for how species came to be. Does that then mean it was wrong!

If you just read the 6th chapter of Darwin's book "The Origin of Species" you'll realize everything he said was nothing.

Why don't you read it then.

Before darwin, atheist were there, but when he wrote a book, they found a way out, and started to believe this theory comletly unconditionally. Reason? "They are afraid, that if somebody proves to them the existance of God, the'll have to obey God's orders."

That is a prity poor assumption.

What they fail to realize is, that If suppose God dosen't exist, then people who believe in God will too become sand with the athiests, but what if God existed? Where will the Athiests go then? There will be no way back to earth. Just on a blind assumption, are you going to risk you whole life of etternity?

"if"........

Allah promises that if you follow his commandments complely, he'll give you a happy life here, as well as in the hereafter, this is what keeps me connected to Islam. Because Alhamdulilah, before following Islam, I had no connection with peace of Mind, and Now I have, its hardly a year now.

Yes, many people find peace in faith.

Darwin thought that the new scientific research will help confirm his theory, but it did exactly the opposite:

Do you mean like modern Gentecs?

1. His thory dosen't speak anything about how life "STARTED", it dose talk about its transformation, but nowhere in his book he wrote any logical reson of how the life "STARTED" on earth.

And quite right to. The theory of evolution does not and never did seek the origins of the first living matter. Evolution is not interested how life started that is the theory of abiogenesis (how many times do I have to say that)!

2. There is not a single scientific research which has proved that the self-existant machanism can give birth to Life.

Wrong theory (again).

3. The fossils that the Geologists have found are "SHOUTING" that this theory is completly incorrect. (Reffer to the post below)

I will.

The first point says that about sevral billion years ago, there was a single cell, which gave rise to humans etc. Therefore, where when and who took the first and foremost step?

What do you mean "where when and who took the first steps" exactly.

This theory says that Inanimate Matter just coninsidently give birth to the first animal on the planet.

It says no such thing actually. Please check the definition for "evolution" and you will see you error.

Imagin.. coninsidently.. All humans, trees are formed. Humans and trees have nothing in common at all. Yet, they are transformed form of one Another..

hhhmmm, this is a fallacy. ALL life for example share the same genetic moleculor clock which is one of many examples of similarity. We are all made of the same atoms too. All life and non life matter are constructed of the same atoms.

After 5 years of Darwin's book, Louis Pasteur's research completely disregarded the theory of Evolution, in his book he mentioned that "The Idea that living things take birth from non-living is burried for ever in the graveyard of the History."

I agree 100%. and I wish it was buried but people still go on (just like you) and consistently fail to grasp the definition of evolution in that it never did and never has attempted to describe how life came from non-living life. That is a different theory. Louis Pastuer's research has been a waste of time attempting to disprove what was clearly never claimed in the first place.

I can write another book on this topic, if everybody is willing to read and reply, but with LOGIC, not that "I dont want to do that..", "I want to do that.."

I would prefer you firmiliarise yourself to what the definition of evolution actually is first!

No body cares what you want to do and what you don't want to do, comeup with a logic.

Never mind logic, I would prefer you to come up with the "basics" of evolution first!

[------]

Never mind logic, I would prefer you to come up with the "basics" of evolution first!

Logic is the basics :rollseyes If ya dont have logic den its mashed

[HeiGou]

did you know that darwin believed in God?

i do RE and the other thing is, our teacher always tells us not to say ''darwin believed blaa blaa..'' because he did NOT believe his theory of evolution, but others took his theory and developed views from it!

Darwin studied for the priesthood, but moved away from any belief in real organised religion. He kept those views quiet because it was dangerous to be an atheist in public and because his wife was pious and it upset her.

And Darwin did, most definitely, believe in the theory of evolution. Read his works.

[------]

Nothing common sense in them anyway so y bother :rollseyes

[root]

Root - Never mind logic, I would prefer you to come up with the "basics" of evolution first!

Logic is the basics If ya dont have logic den its mashed

Logic does not count for much at this point. Allow me to explain, if we want to logically discuss evolution let us first define it:

The change in allele frequency in a population over time

Where in this statement does it state life from non-life? We cannot begin to look at something "logically" if you don't even start from the correct perspective.

[root]

A 300-million-year-old cockroach, with exactly the same features as cockroaches today. This fossil, which lived 300 million years ago, definitively refutes Darwin's theory of evolution

This is another misleading statement. Cockroaches are one of the oldest (and most succesful) species in the insect world and it's no surprise that some species have not changed in all that time. We also have an abundent of cockroaches that have diversified into other niche environments and differ quite vastly from the fossils which shows that diversification is real.

Far from refuting the theory of evolution it actually supports it.........

[root]

The coelacanth,

The modern coelacanth is Latimeria chalumnae, in the family Latimeriidae. Fossil coelacanths are in other families, mostly Coelacanthidae, and are significantly different in that they are smaller and lack certain internal structures. Latimeria has no fossil record, so it cannot be a "living fossil."

Even if the modern coelacanth and fossil coelacanths were the same, it would not be a serious problem for evolution. The theory of evolution does not say that all organisms must evolve. In an unchanging environment, natural selection would tend to keep things largely unchanged morphologically.

Coelacanths have primitive features relative to most other fish, so at one time they were one of the closest known specimens to the fish-tetrapod transition. We now know several other fossils that show the fish-tetrapod transition quite well.

[czgibson]

Greetings,

Thanks for telling me that I can find answers to my question in earlier pages, that was a really strange thing, I was shocked to read that.

Obviously you weren't sufficiently shocked to the point where you actually would go back and read!

The main thing we need to discuss is "Darwin HIM SELF DID NOT BELIEVE IN HIS OWN THEORY!" Then why the heck is everybody else so blind?!?

As I said, the scientific community really needs to be informed of this. Sadly, your hack-job extracts from Darwin will convince nobody who is familiar with reading. The quotes you've given show doubts and difficulties that Darwin faced, but they in no way amount to the claim that he didn't believe his own theory!

The reason why everyone is so "blind" to this idea of yours (if indeed you are the originator of this idea, which I highly doubt) is because it is simply nonsensical, as others in this thread have tried to show you.

Atleast READ THE WHOLE BOOK? If you cannot, ATLEAST READ THE WHOLE CHAPTER?

It would be a good start, and I echo HeiGou when I say "Please do!"

root kept talking about: logic.. etc. what ever that was, Is that all logical?

If you're not familiar with logic, just send me a PM and I can point you in the direction of some good introductions to it.

Will you believe that which root is writing here on the forum, or that which Darwin HIM SELF wrote in the book which is for sale out there at a very low price, WHICH ONE WILL YOU BELIEVE?!?

False dilemma. As far as this debate goes, I know whose side Darwin would be on.

The time in which darwin was living, people used to believe in things like "Living born out of dead" (Spontaneous Generation) because they thought that when rotten meat is left alone, some small germs are born over it bla bla, that's why living beings can get life from dead.

People believed that up until the 17th century. Darwin lived during the 19th century.

If you just read the 6th chapter of Darwin's book "The Origin of Species" you'll realize everything he said was nothing.

If you read it you'll find out that that claim is false.

Before darwin, atheist were there, but when he wrote a book, they found a way out, and started to believe this theory comletly unconditionally.

I take it you've never heard about the many debates that take place among evolutionary biologists?

What they fail to realize is, that If suppose God dosen't exist, then people who believe in God will too become sand with the athiests, but what if God existed? Where will the Athiests go then? There will be no way back to earth. Just on a blind assumption, are you going to risk you whole life of etternity?

That's called Pascal's Wager. It's quite an old idea.

Allah promises that if you follow his commandments complely, he'll give you a happy life here, as well as in the hereafter, this is what keeps me connected to Islam.

Do you only believe in god because you want to be rewarded? What kind of faith is that?

Because Alhamdulilah, before following Islam, I had no connection with peace of Mind, and Now I have, its hardly a year now.

Well, I'm glad it's brought you happiness.

Darwin thought that the new scientific research will help confirm his theory, but it did exactly the opposite:

1. His thory dosen't speak anything about how life "STARTED", it dose talk about its transformation, but nowhere in his book he wrote any logical reson of how the life "STARTED" on earth.

Correct, because, as has been pointed out hundreds of times before, that has nothing to do with evolution. Abiogenesis is the area you're thinking of.

2. There is not a single scientific research which has proved that the self-existant machanism can give birth to Life.

Correct. This means that god's creation of the universe has no scientific support, doesn't it?

3. The fossils that the Geologists have found are "SHOUTING" that this theory is completly incorrect. (Reffer to the post below)

Have you talked to any geologists lately?

The first point says that about sevral billion years ago, there was a single cell, which gave rise to humans etc. Therefore, where when and who took the first and foremost step?

This theory says that Inanimate Matter just coninsidently give birth to the first animal on the planet.

Imagin.. coninsidently.. All humans, trees are formed. Humans and trees have nothing in common at all. Yet, they are transformed form of one Another..

After 5 years of Darwin's book, Louis Pasteur's research completely disregarded the theory of Evolution, in his book he mentioned that "The Idea that living things take birth from non-living is burried for ever in the graveyard of the History."

Most of this is to do with abiogenesis, not evolution. The part that could be related to evolution is the third paragraph, but your use of the word "coninsidently" shows that you're not talking about evolution as currently understood by biologists.

I would request my athiesm-supporting brothers to post a brief, and "TO THE POINT" reply.

It takes quite some time to untangle so many misconceptions! I've also deliberately left out the ones that have been covered by others!

No body will read a tale of 5 generations if you posted the way you are doing it in previous posts. Be brief, to the point, and logical.

Why the hostility to reading our posts? What's wrong with them?

Peace

[Muhammad Waqqas]

So can I save us all a lot of time and ask which Muslim apologetics site you cribbed this from?

Oh no I'm scared :-\

----

Because you know, this is not such a difficult question to ask. If you really are indoubt that it is copied, simply try googling it. End of the story?

----

Now if you JUST ONCE read the lame logics he has provided, you'll realize theses people are not worth debating with. Even if my grandma would have read, even she would have realized it.

Next, he quotes my post, which I extracted from "Origion of species" and writes down under it: "Because we do."

Imagin, Darwin said something, and here we have another person contradicting with what he said.. Darwin is not agreeing, this ultra-special guy is here telling us what darwin "Really" meant.

Next, again, what darwin could not realize him self, he is here to explain for us that same thing, again and again, the same thing..

This one-line reply is sufficient to reply all of your tale of 5-generations:
WE ARE SAYING, THAT DARWIN DID NOT AGREE WITH HIS OWN THEORY, WE DON'T WANT YOU TO JUSTIFY THE PROBLEMS OF THE THEORY FOR US.

What confuses you athiests so much?!?

Well yes it is possible as Darwin agreed. And as study of the eye shows, it proves evolution because it is not a wonderful structure but a messy, poorly designed organ that clearly evolved.

You know, this one really makes me hit my head with the wall..

Who are you trying to fool here? Who? I know there might be some people in the forum who don't know much about this theory, but there are some who do Know about it!

The Techonology in the Eye:

This is another subject that remains unanswered by evolutionary theory. It is
the excellent quality of perception in the eye and the ear.
Before passing on to the subject of the eye, let us briefly answer the
question of how we see. Light rays coming from an object fall oppositely
on the eye's retina. Here, these light rays are transmitted into electric
signals by cells and reach a tiny spot at the back of the brain, the
"Center of Vision." These electric signals are perceived in this center as
an image after a series of processes. With this technical background, let
us do some thinking.

The brain is insulated from light. That means that its inside is completely
dark, and that no light reaches the place where it is located.
Thus, the "center of vision" is never touched by light and may even be
the darkest place you have ever known. However, you observe a luminous,
bright world in this pitch darkness.

The image formed in the eye is so sharp and distinct that even the
technology of the twentieth century has not been able to attain it. For
instance, look at the monitor you are looking at, your hands with which you
are holding the mouse, and then lift your head and look around you. Have you
ever seen such a sharp and distinct image as this one at any other
place? Even the most developed television screen produced by the
greatest television producer in the world cannot provide such a sharp
image for you. This is a three-dimensional, colored, and extremely

sharp image. For more than 100 years, thousands of engineers have
been trying to achieve this sharpness. Factories, huge premises were
established, much research has been done, plans and designs have
been made for this purpose. Again, look at a TV screen and the book
you hold in your hands. You will see that there is a big difference in
sharpness and distinction. Moreover, the TV screen shows you a twodimensional image, whereas with your eyes, you watch a three-dimensional perspective with depth.

For many years, tens of thousands of engineers have tried to make
a three-dimensional TV and achieve the vision quality of the eye. Yes,
they have made a three-dimensional television system, but it is not
possible to watch it without putting on special 3-D glasses; moreover,
it is only an artificial three-dimension. The background is more
blurred, the foreground appears like a paper setting. Never has it been
possible to produce a sharp and distinct vision like that of the eye. In

both the camera and the television, there is a loss of image quality.
Evolutionists and athiests claim that the mechanism producing this sharp and distinct image has been formed by chance. Now, if somebody told you
that the television in your room was formed as a result of chance, that
all of its atoms just happened to come together and make up this device
that produces an image, what would you think? How can atoms
do what thousands of people cannot?

If a device producing a more primitive image than the eye could not
have been formed by chance, then it is very evident that the eye and the
image seen by the eye could not have been formed by chance. The
same situation applies to the ear. The outer ear picks up the available
sounds by the auricle and directs them to the middle ear, the middle
ear transmits the sound vibrations by intensifying them, and the inner
ear sends these vibrations to the brain by translating them into electric
signals. Just as with the eye, the act of hearing finalizes in the center of
hearing in the brain.

Because a species is usually defined as that which produces sterile offspring if at all. This is obviiously proof of evolution - if two species could interbreed they would be one species.

Who asked you to clear the problems in the theory for us? We are saying Darwin did not agree. What has your justifucation to do with this concerning topic?

Umm, not by Darwin's time they did not.

Nice, We will agree with "YOUR OPINION HERE." I already gave the reply in my last post. COMEUP WITH FACTS. NOBODY CARES WHAT YOU THINK. Atleast I don't. Seriously.

And how do you explain the existence of religiously observant Christian, Jewish and even Muslim biologists who accept God and Darwin's theory?

Why would people be afraid of obeying God anyway? It is not as if Islam is a difficult religion!

Ah...

----

WHICH CHRISTIAN, JEWISH AND MUSLIM BIOLOGIST ACCEPTS DARWIN'S THEORY?

I agree that they are taught this theory in books, BUT WHICH BIOLOGISTS ACCEPTS THE THEORY?!! GIVE ME NAME OF ONLY ONE!

The first evolutionist who took up the subject of the origin of life in the twentieth century was the renowned Russian biologist Alexander Oparin. With various theses he advanced in the 1930s, he tried to prove that a living cell could originate by coincidence. these studies, however, were doomed to failure, and Oparin had to make the following confession:

"Unfortunately, however, the problem of the origin of the cell is perhaps the most obscure point in the whole study of the evolution of organisms." (Alexander I. Oparin, Origin of Life, Dover Publications, New York, 1936, 1953 (reprint), page. 196.)

British paleontologist, Derek V. Ager, admits this fact, even though he is an evolutionist:

"The point emerges that if we examine the fossil record in detail, whether at the level of orders or of species, we find—over and over again—not gradual evolution, but the sudden explosion of one group at the expense of another." (Derek Ager, "The Nature of the Fossil Record", Proceedings of the British Geological Association, vol 87, 1976, page. 133.)

Which is not true. Look up the Miller Experiment

Let's look up the Miller Experiment:

The best known experiment to prove evolution was carried out by the American chemist Stanley Miller in 1953. Combining the gases he alleged to have existed in the primordial Earth's atmosphere in an experiment set-up, and adding energy to the mixture, Miller synthesized several organic molecules (amino acids) present in the structure of proteins. Barely a few years had passed before it was revealed that this experiment, which was then presented as an important step in the name of evolution, was invalid, for the atmosphere used in the experiment was very different from the real Earth conditions. (For details: "New Evidence on Evolution of Early Atmosphere and Life", Bulletin of the American Meteorological Society, vol 63, November 1982, page.1328-1330.)

Miller him self confessed that the atmosphere medium he used was unrealistic: Stanley Miller, Molecular Evolution of Life: Current Status of the Prebiotic Synthesis of Small Molecules, 1986, page. 7.

Actually they shout precisely the opposite.

----

How does Pasteur's work relate to Darwin's?

It tells us two things:

At darwin's times, spontaneous generation, which asserts that non-living materials came together to form living organisms, had been widely accepted. It was commonly believed that insects came into being from food leftovers, and mice from wheat. Interesting experiments were conducted to prove this theory. Some wheat was placed on a dirty piece of cloth, and it was believed
that mice would originate from it after a while.

Similarly, maggots developing in rotting meat was assumed to be evidence of spontaneous generation.

Louis Pasteur destroyed the belief that life could be created from inanimate substances. It was later understood that worms did not appear on meat spontaneously, but were carried there by flies in the form of larvae, invisible to the naked eye.

Since Louis Pasteur wrote is book 5 years after darwin, therefore it also proves that at darwin's times, this belief really existed (To which you disagreed above).

More?

[Muhammad Waqqas]

Is this the best you can come up with? Darwin does not say that animals have to evolve and change. It is not complusory. If they find a small and uncompetitive niche, or they arrive at a form that is well adapted to their way of life, it is entirely possible that they will remain as they are for a long time. That does not disprove evolution. After all what is the alternative? That God did such good work on cockroaches that He left the design alone for 300 million years, but He did not like Hummingbirds so He has kept fiddling with their design? I mean, the idea is absurd. This does not even begin to disprove evolution although all the other species which are not 300 million years old strike a blow against the idea that God created life without evolution.

Ladies and gentlemen, we would love to anouce that the Theory of Evolution has just been modified by our Nobel Prize Winner, Mr. HeiGou! Clapping!

You are only speaking about the process of Natural Selection, and there are other people besides you who know of that too:

Darwin based his evolution allegation entirely on the mechanism
of "natural selection." The importance he placed on this mechanism
was evident in the name of his book: The Origin of Species, By Means
of Natural Selection… Natural selection holds that those living things that are stronger and more suited to the natural conditions of their habitats will survive in the struggle for life. For example, in a deer herd under the
threat of attack by wild animals, those that can run faster will survive.
Therefore, the deer herd will be comprised of faster and stronger individuals. However, unquestionably, this mechanism will not cause deer to evolve and transform themselves into another living species, for instance, horses.
Therefore, the mechanism of natural selection has no evolutionary power. Darwin was also aware of this fact and had to state this in his book The Origin of Species:

Natural selection can do nothing until favourable individual differences
or variations occur. (Charles Darwin, The Origin of Species by Means of Natural Selection, The Modern Library, New York, page. 127.)

So, how could these "favorable variations" occur? Darwin tried to answer this question from the standpoint of the primitive understanding of science at that time. According to the French biologist Chevalier de Lamarck (1744-1829), who lived before Darwin, living creatures passed on the traits they acquired during their lifetime to the next generation. He asserted that these traits, which accumulated from one generation to another, caused new species to be formed. For instance, he claimed that giraffes evolved from antelopes;as they struggled to eat the leaves of high trees, their necks
were extended from generation to generation. Darwin also gave similar examples. In his book The Origin of Species, for instance, he said that some bears going into water to find food transformed themselves into whales over time. (Charles Darwin, The Origin of Species: A Facsimile of the First Edition,
Harvard University Press, 1964, page. 184.).

However, the laws of inheritance discovered by Gregor Mendel (1822-84) and verified by the science of genetics, which flourished in the twentieth century, utterly demolished the legend that acquired traits were passed on to subsequent generations. Thus, natural selection fell out of favor as an evolutionary mechanism.

More?

[Muhammad Waqqas]

And then darwin went on to say:

The two first heads shall be here discussed Instinct and Hybridism in separate chapters. On the Blah Blah Blah...

You know root, your problem is not just less-knowledge, your problem is something much more serious that that. What is the problem? The problem that you have is Stupidity. And believe me, stupidity is a serious deases, by reading your post I think you may have it. Check up with some doctor, here are some of its symptoms:

1) You reply to a post without even knowing the topic/question.
2) You quote things which mean nothing to anyone, not even to the discussion.
3) You keep on talking to your self.
4) You don't read the post completly.

Read the first post of the page where your post is recorded and READ-IT-CAREFULLY!

I asked you to remain brief. I can explain for 5 pages, but you should remain brief. Because Atheist usually keep on blabing irrelivent things just to fillup their posts and satisfy them selves that there is no God.

Read the above reply, It has answers to 95% of your irrelivent and illogical arguments.

Point # 1:

On the absence or rarity of transitional varieties. As natural selection acts solely by the preservation of profitable modifications, each new form will tend in a fully-stocked country to take the place of, and finally to exterminate, its own less improved...

What was I trying to prove? That he did not give the theory? No! That he did not believe in the theory. This whole pagragraph you posted is irrelivent.

Point # 2:

To be honest I think you should have taken the advice of the author of the below words because I think you ...

Like I said, these athiests, they can NEVER come up with a logic.

You know, this is the reson I never feel that these brain dead dolts can comeup with a logic. What the heck has this line to do, with the topic we are discussing?!? NOTHING!!!

root, besides replying to my points, he starts speaking about cut-and-paste. What has cut-and-paste to do with Darwin not believing in his own theory?!?

Kid, I have the book with me, don't worry. I don't need links. And I assume, that you have read the book, since you really sent me a link to chapter 6. Why the heck did you not quote the answers?!?

Why don't you take the advice of the original author of your words. here is the chapter in full:

Again, self-assumption.. Just like his other Athiest fellow, the same self assumption, you have copied, you have pasted BLAH BLAH BLAH..

Are there no more logical Athiests any more?!?

Do you think the validity of a book be judged by it's price?

Arrrrghhhh!!! ATLEAST READ THE WHOLE LINE?!? And analyze what I wrote:

Will you believe that which root is writing here on the forum, or that which Darwin HIM SELF wrote in the book which is for sale out there at a very low price, WHICH ONE WILL YOU BELIEVE?!?

I am not emphisising on price here! And above all, why would you really quote the paragraph? What has price to do with darwin not believing in his own theory?

What do you mean "where when and who took the first steps" exactly.

Who created the first cell.
Its english.

if.......

Yea right, "IF". Suppose somebody tells me to wear a dress which will protect me from fire. And he tells me to enter a room, the room in which everybody has to enter, and the room according to some people is full of fire.. And I say "OH, I haven't seen the fire, I won't wear the dress to protect my self from fire, huh? I"m being logical, see? I won't wear it!"

IF..... there is fire.. than there will be no turning back.. If there is no fire, then those who are wearing the same dress, even they will not be harmed.

So I also included the "IF", if you would have really read and analyzed what I wrote.

hhhmmm, this is a fallacy. ALL life for example share the same genetic moleculor clock which is one of many examples of similarity. We are all made of the same atoms too. All life and non life matter are constructed of the same atoms.

THIS DOSE NOT PROVE THE THEORY CORRECT.

Everything indeed is made up of atoms? Even the tables, chairs, walls, sand, computres and cares, even they are madeup of Atoms. So? Dose that mean you are evolved from them?

[HeiGou]

Nothing common sense in them anyway so y bother :rollseyes

With all due respect Ms Pagal (and that is you with a new name isn't it?), how do you know if you haven't read anything he wrote or even begun to understand what he said? I do not urge you to go out and read his works, because it may upset your Faith and would be a waste of your time anyway, but perhaps you could show Darwin a little more respect?

[HeiGou]

Oh no I'm scared :-\

Well that puts an age to you fairly effectively.

You know, this is the reson I never feel that these brain dead dolts can comeup with a logic. What the heck has this line to do, with the topic we are discussing?!? NOTHING!!!

Actually it has a lot to do with it. Considering your youthful age and lack of any basic scientific knowledge, it is likely you will misunderstand and misquote the Apologist site you are quoting from and so if I know which one it is you are cribbing from I can go there, read it, and correct your posts when you make a mistake.

Next, he quotes my post, which I extracted from "Origion of species" and writes down under it: "Because we do."

Well nothing more is needed. You say we do not find intermediaries and we do. Simple.

WE ARE SAYING, THAT DARWIN DID NOT AGREE WITH HIS OWN THEORY, WE DON'T WANT YOU TO JUSTIFY THE PROBLEMS OF THE THEORY FOR US.

You can say that all you like but it will not become any more true through repetition. Darwin did believe in his theory and went to his grave defending it.

You know, this one really makes me hit my head with the wall..

Who are you trying to fool here? Who? I know there might be some people in the forum who don't know much about this theory, but there are some who do Know about it!

The Techonology in the Eye:
This is another subject that remains unanswered by evolutionary theory. It is the excellent quality of perception in the eye and the ear. Before passing on to the subject of the eye, let us briefly answer the question of how we see. Light rays coming from an object fall oppositely on the eye's retina. Here, these light rays are transmitted into electric signals by cells and reach a tiny spot at the back of the brain, the "Center of Vision." These electric signals are perceived in this center as an image after a series of processes. With this technical background, let us do some thinking. The brain is insulated from light. That means that its inside is completely dark, and that no light reaches the place where it is located. Thus, the "center of vision" is never touched by light and may even be the darkest place you have ever known. However, you observe a luminous, bright world in this pitch darkness. The image formed in the eye is so sharp and distinct that even the technology of the twentieth century has not been able to attain it.

This is not true as Westerners have been able to build much better lenses for some time.

For instance, look at the monitor you are looking at, your hands with which you are holding the mouse, and then lift your head and look around you. Have you ever seen such a sharp and distinct image as this one at any other place?

With some other form of eye perhaps? Come on, this is childish.

Even the most developed television screen produced by the greatest television producer in the world cannot provide such a sharp image for you. This is a three-dimensional, colored, and extremely sharp image. For more than 100 years, thousands of engineers have been trying to achieve this sharpness. Factories, huge premises were established, much research has been done, plans and designs have been made for this purpose. Again, look at a TV screen and the book you hold in your hands. You will see that there is a big difference in sharpness and distinction. Moreover, the TV screen shows you a twodimensional image, whereas with your eyes, you watch a three-dimensional perspective with depth.

All this nonsense has nothing to do with evolution of course. And if you thought about it for a minute you would realise that computer monitors are above all else, cheap and so their quality tends to be poor - but they are getting better. Yet Americans can build satellites that can read number plates from outer space. And in 3-D too. So self evidently, scientists can build better lenses than the human eye. Is this the best you can do?

>nonsense deleted<Now, if somebody told you that the television in your room was formed as a result of chance, that all of its atoms just happened to come together and make up this device that produces an image, what would you think? How can atoms do what thousands of people cannot?

]

Same old argument - "I am too stupid to think of how this might have occurred therefore it is the work of God". And it is just as wrong now as it ever has been. Eyes do not evolve purely through chance. Eyes evolve through evolution which is, locally, directed. Not random.

So ask the tough question about the eye - the light coems in through the lens and hits the back of the eye where the light is detected by detectors which join together in the optic nerve which runs to the brain. The sensible design would be for the detectors to face towards the front of the eye and for the nerve to run from their back to the optic nerve behind the eyeball. But they do not. They face away from the lens, the nerves join at the back and then the optic nerve, inside the eyeball, has to pass through the back of the eye, blocking a large part of your vision (you have a black spot to the upper outer side of each eye as a result). This is poor design or it is the result of the eye evolving without any designer. Why else would the eye be back to front?

Who asked you to clear the problems in the theory for us? We are saying Darwin did not agree. What has your justifucation to do with this concerning topic?

You did. You are wrong if you say Darwin did not agree.

Are you 12 or something? Or is it English that you cannot read? Seriously, I mean after reading this part of your post, I seriously don't know why am I replying you.

Please do not feel you need to.

WHICH CHRISTIAN, JEWISH AND MUSLIM BIOLOGIST ACCEPTS DARWIN'S THEORY?

How about Sálim Ali, born Sálim Moizuddin Abdul Ali, (November 12, 1896 - July 27, 1987), Stanley Cohen (born November 17, 1922) as for christians, take your pick.

I agree that they are taught this theory in books, BUT WHICH BIOLOGISTS ACCEPTS THE THEORY?!! GIVE ME NAME OF ONLY [U]ONE

!

Stephen Jay Gould. Richard Dawkins. You name one. Which biologists do not is the more relevant question.

British paleontologist, Derek V. Ager, admits this fact, even though he is an evolutionist:

"The point emerges that if we examine the fossil record in detail, whether at the level of orders or of species, we find—over and over again—not gradual evolution, but the sudden explosion of one group at the expense of another." Derek Ager, "The Nature of the Fossil Record", Proceedings of the British Geological Association, vol 87, 1976, page. 133.)

Sure. What is called Punk-Ek. But still Darwinian. You cannot take a quote out of context and claim it is a refutation of Darwinism when it is the opposite.

Let's look up the Miller Experiment:
The best known experiment to prove evolution was carried out by the American chemist Stanley Miller in 1953. Combining the gases he alleged to have existed in the primordial Earth's atmosphere in an experiment set-up, and adding energy to the mixture, Miller synthesized several organic molecules (amino acids) present in the structure of proteins. Barely a few years had passed before it was revealed that this experiment, which was then presented as an important step in the name of evolution, was invalid, for the atmosphere used in the experiment was very different from the real Earth conditions. (For details: "New Evidence on Evolution of Early Atmosphere and Life", Bulletin of the American Meteorological Society, vol 63, November 1982, page.1328-1330.)

Why don't you look up what that article says and get back to me?

Miller him self confessed that the atmosphere medium he used was unrealistic: Stanley Miller, lecular Evolution of Life: Current Status of the Prebiotic Synthesis of Small Molecules, 1986, page. 7.

Well that is not quite a fair claim about what he said. Again why don't you read it and get back to us?

It tells us two things:

At darwin's times, spontaneous generation, which asserts that non-living materials came together to form living organisms, had been widely accepted. It was commonly believed that insects came into being from food leftovers, and mice from wheat. Interesting experiments were conducted to prove this theory. Some wheat was placed on a dirty piece of cloth, and it was believed
that mice would originate from it after a while.

No one had defend Spontaneous Generation for about 200 years when Darwin came along. It had been proven wrong with the first microscopes. It has nothing to do with Darwin at all - who did not, by the way, comment much on the origins of life.

Louis Pasteur destroyed the belief that life could be created from inanimate substances. It was later understood that worms did not appear on meat spontaneously, but were carried there by flies in the form of larvae, invisible to the naked eye. Since Louis Pasteur wrote is book 5 years after darwin, therefore it also proves that at darwin's times, this belief really existed (To which you disagreed above).

Let me quote

Nevertheless, experimental scientists continued to roll back the frontiers within which the spontaneous generation of complex organisms could be observed. The first step was taken by the Italian Francesco Redi, who, in 1668, proved that no maggots appeared in meat when flies were prevented from laying eggs. From the seventeenth century onwards it was gradually shown that, at least in the case of all the higher and readily visible organisms, spontaneous generation did not occur, but that omne vivum ex ovo, every living thing came from a pre-existing living thing.

Then in 1683 Antoni van Leeuwenhoek discovered bacteria, and it was soon found that however carefully organic matter might be protected by screens, or by being placed in stoppered receptacles, putrefaction set in, and was invariably accompanied by the appearance of myriad bacteria and other low organisms. As knowledge of microscopic forms of life increased, so the apparent realm of abiogenesis increased, and it became tempting to hypothesise that while abiogenesis might not take place for creatures visible to the naked eye, there existed a fount at the microscopic level from which living organisms continually arose from inorganic matter.

In 1768 Lazzaro Spallanzani proved that microbes came from the air, and could be killed by boiling. Yet it was not until 1862 that Louis Pasteur performed a series of careful experiments which conclusively proved that a truly sterile medium would remain sterile.

So 180 years before Darwin's book, van Leeuwenhoek proved SG was wrong. So your entire argument collapses. Not that SG has anything to do with evolution at all, it is to do with the origins of life abotu which Darwin did not talk much.

More?

Got anything?

[HeiGou]

Ladies and gentlemen, we would love to anouce that the Theory of Evolution has just been modified by our Nobel Prize Winner, Mr. HeiGou! Clapping!

Thank you, thank you. But alas I have modified nothing. To the ignorant old ideas look new.

You are only speaking about the process of Natural Selection, and there are other people besides you who know of that too:

[indent]Darwin based his evolution allegation entirely on the mechanism of "natural selection." The importance he placed on this mechanism was evident in the name of his book: The Origin of Species, By Means of Natural Selection… Natural selection holds that those living things that are stronger and more suited to the natural conditions of their habitats will survive in the struggle for life. For example, in a deer herd under the threat of attack by wild animals, those that can run faster will survive.
Therefore, the deer herd will be comprised of faster and stronger individuals. However, unquestionably, this mechanism will not cause deer to evolve and transform themselves into another living species, for instance, horses.

Do you doubt that if the slow deer are eaten the faster deer will survive and so over time the deer herd will become faster?

And that "unquestionable" shows the stupidity of the author and of course no one says deer will become horses. They may, however, become something else.

Therefore, the mechanism of natural selection has no evolutionary power. Darwin was also aware of this fact and had to state this in his book The Origin of Species: Natural selection can do nothing until favourable individual differences or variations occur. Charles Darwin, The Origin of Species by Means of Natural Selection, The Modern Library, New York, page. 127.)

Which is perfectly true and utterly irrelevant to your claims above. It is clear that variation in deer does occur - some are faster than others, no two looks exactly alike.

So, how could these "favorable variations" occur? Darwin tried to answer this question from the standpoint of the primitive understanding of science at that time. According to the French biologist Chevalier de Lamarck (1744-1829), who lived before Darwin, living creatures passed on the traits they acquired during their lifetime to the next generation. He asserted that these traits, which accumulated from one generation to another, caused new species to be formed. For instance, he claimed that giraffes evolved from antelopes;as they struggled to eat the leaves of high trees, their necks were extended from generation to generation. Darwin also gave similar examples. In his book The Origin of Species, for instance, he said that some bears going into water to find food transformed themselves into whales over time. However, the laws of inheritance discovered by Gregor Mendel (1822-84) and verified by the science of genetics, which flourished in the twentieth century, utterly demolished the legend that acquired traits were passed on to subsequent generations. Thus, natural selection fell out of favor as an evolutionary mechanism.

This is utterly ignorant. Darwin rejected Lamarckian theories. There is no point attempting to claim that Darwin was a Lamarkian when he was not. It is in fact amazing that Darwin, without understanding genetics, nonetheless did a verty good job of working out how it all worked. DNA simply proves Darwin right. AS you would know if you had done as much as High School biology.

More?

I am waiting for you to start.

[IbnAbdulHakim]

With all due respect Ms Pagal (and that is you with a new name isn't it?), how do you know if you haven't read anything he wrote or even begun to understand what he said? I do not urge you to go out and read his works, because it may upset your Faith and would be a waste of your time anyway, but perhaps you could show Darwin a little more respect?

i actually did read his book and i couldnt stop laughing, it was a nice lot of jokes :D

[HeiGou]

i actually did read his book and i couldnt stop laughing, it was a nice lot of jokes :D

What did you think was funny about it?

[IbnAbdulHakim]

What did you think was funny about it?

he thinks we use to be monkeys before :) , lol imagine if a kid comes up2u and says, did you know that toilets use to be able to talk :eek:

[HeiGou]

he thinks we use to be monkeys before :) , lol imagine if a kid comes up2u and says, did you know that toilets use to be able to talk :eek:

Well there are obvious similarities between us and the great apes. In fact if you look at the skeletons of all mammals it is obvious that we are really similar. Go to your local museum and have a look. Now it is also obvious that human bones and monkey bones are really really similar. In fact if they did not bend the skeleton in museums to make them look more ape-like I doubt that you would be able to tell a gorilla skeleton from a human one. If you look at live gorillas or chimpanzees it is also obvious that we are a lot alike. I don't think that even Creationists would deny that fundamental similarities between us and the great apes. Besides, which book are you thinking of? Darwin was very careful about upsetting people and talking about monkeys.

Just in passing, Darwin wrote during the Victorian period when everyone had more time and was a lot more serious. So his books are not packaged in the "sound-bite" style of modern authors. They take a lot of time and some serious thinking, but he is very sensible and I would recommend him in general.

[IbnAbdulHakim]

Well there are obvious similarities between us and the great apes. In fact if you look at the skeletons of all mammals it is obvious that we are really similar. Go to your local museum and have a look. Now it is also obvious that human bones and monkey bones are really really similar. In fact if they did not bend the skeleton in museums to make them look more ape-like I doubt that you would be able to tell a gorilla skeleton from a human one. If you look at live gorillas or chimpanzees it is also obvious that we are a lot alike. I don't think that even Creationists would deny that fundamental similarities between us and the great apes. Besides, which book are you thinking of? Darwin was very careful about upsetting people and talking about monkeys.

Just in passing, Darwin wrote during the Victorian period when everyone had more time and was a lot more serious. So his books are not packaged in the "sound-bite" style of modern authors. They take a lot of time and some serious thinking, but he is very sensible and I would recommend him in general.

i understand your theories and form of thinking, you have certain logic behind your words. But truth is many things resemble others, a pen resembles a pencil yet both are completely different in essence! A leopard resembles a jaguar yet both are very different! A tiger is close to a lion yet both are very different! A crocodile luks like an Eel sum mite say yet both are very different! Why after so many years is there no direct proof of evolution if it did exist yet tons of proof comes out proving the quran to be the true word of Allah swt?

:peace: :)

[------]

^^^^ Respect Akhee!! :D

[HeiGou]

i understand your theories and form of thinking, you have certain logic behind your words.

Well alas I can claim little as my own.

But truth is many things resemble others, a pen resembles a pencil yet both are completely different in essence! A leopard resembles a jaguar yet both are very different! A tiger is close to a lion yet both are very different! A crocodile luks like an Eel sum mite say yet both are very different!

Well absolutely. And there is a problem because animals often evolve to fill niches - so if two creates evolve to fill the same niche at different times or in different places, they will often look a like. The Ichthyosaurs (see http://en.wikipedia.org/wiki/Ichthyosaur) looks a lot like a dolphin or a small whale. The Tasmanian tiger looked a lot like a wolf even thought it was related to kangaroos. So this is not proof of evolution, but it is proof of our relationship with other creatures including monkeys. I do not mind if you say that God was economical and so used the same basic plan for all mammals and even more so for all primates (that's us and the apes), but it is obvious that we are closely related to the great apes. Even if you look at them, especially young ones, you can see we are kin - no matter how that relation arose.

Why after so many years is there no direct proof of evolution if it did exist yet tons of proof comes out proving the quran to be the true word of Allah swt?

There is ample evidence of evolution. We see it in MRSA, we see it in some plant species, it is the only way to explain the fossil record and life as we can see it today.

[IbnAbdulHakim]

There is ample evidence of evolution. We see it in MRSA, we see it in some plant species, it is the only way to explain the fossil record and life as we can see it today.

You are speaking of the similarities again, this is no proof that one came from the other.

as for fossils chek this out:

THE FOSSIL RECORD DENIES THE THEORY OF EVOLUTION

^^The theory of evolution maintains that different groups of living things (phyla) developed from a common ancestor and grew apart with the passing of time. The diagram left states this claim: According to Darwinism, living things grew apart from one another like the branches on a tree.

But the fossil record shows just the opposite. As can be seen from the diagram left, different groups of living things emerged suddenly with their different structures. Some 100 phyla suddenly emerged in the Cambrian Age. Subsequently, the number of these fell rather than rose (because some phyla became extinct).

Before then, there is no trace in the fossil record of anything apart from single-celled creatures and a few very primitive multicellular ones. All animal phyla emerged completely formed and all at once, in the very short period of time represented by the Cambrian explosion. (Five million years is a very short time in geological terms!)

The fossils found in Cambrian rocks belong to very different creatures, such as snails, trilobites, sponges, jellyfish, starfish, shellfish, etc. Most of the creatures in this layer have complex systems and advanced structures, such as eyes, gills, and circulatory systems, exactly the same as those in modern specimens. These structures are at one and the same time very advanced, and very different.

Richard Monastersky, a staff writer at ScienceNews magazine states the following about the "Cambrian explosion," which is a deathtrap for evolutionary theory:

A half-billion years ago, ...the remarkably complex forms of animals we see today suddenly appeared. This moment, right at the start of Earth's Cambrian Period, some 550 million years ago, marks the evolutionary explosion that filled the seas with the world's first complex creatures.57

The same article also quotes Jan Bergstr&#246;m, a paleontologist who studied the early Cambrian deposits in Chengjiang, China, as saying, "The Chengyiang fauna demonstrates that the large animal phyla of today were present already in the early Cambrian and that they were as distinct from each other as they are today."58

This illustration portrays living things with complex structures from the Cambrian Age. The emergence of such different creatures with no preceding ancestors completely invalidates Darwinist theory.

And lastly chek this:

Phillip Johnson, a professor at the University of California at Berkeley who is also one of the world's foremost critics of Darwinism, describes the contradiction between this paleontological truth and Darwinism:

Darwinian theory predicts a "cone of increasing diversity," as the first living organism, or first animal species, gradually and continually diversified to create the higher levels of taxonomic order. The animal fossil record more resembles such a cone turned upside down, with the phyla present at the start and thereafter decreasing.60


A fossil from the Cambrian Age.
As Phillip Johnson has revealed, far from its being the case that phyla came about by stages, in reality they all came into being at once, and some of them even became extinct in later periods. The diagrams on page 53 reveal the truth that the fossil record has revealed concerning the origin of phyla.



Hope that clears up the fossil business :)


SOURCE: http://www.darwinismrefuted.com/natu...tory_1_02.html

[IceQueen~]

modern science has found that all things originated from water-the Quran said this more than 1400 yrs ago. so yes to some extent the evolution theory may be correct as part of God's great plan for this world to be able to survive by adapting to surroundings but as for humans-we are in the form God created us in-maybe a lot smaller than our anscesters but in the same form

[HeiGou]

modern science has found that all things originated from water-the Quran said this more than 1400 yrs ago. so yes to some extent the evolution theory may be correct as part of God's great plan for this world to be able to survive by adapting to surroundings but as for humans-we are in the form God created us in-maybe a lot smaller than our anscesters but in the same form

I am unconvinced that modern science has found all things originated from water - there is dispute about how much the climate was affected by the rise of life and hence whether the water we see today exists because life made it possible or the other way around. Although admittedly that might just be me.

However, why do you think that we are smaller than our ancestors? Apart, of course, from anything the Quran or aHadith might have to say.

[IbnAbdulHakim]

I am unconvinced that modern science has found all things originated from water - there is dispute about how much the climate was affected by the rise of life and hence whether the water we see today exists because life made it possible or the other way around. Although admittedly that might just be me.

However, why do you think that we are smaller than our ancestors? Apart, of course, from anything the Quran or aHadith might have to say.

plz dont ignore my post :( i am very interested in what you make out of it :peace:

[------]

Apart, of course, from anything the Quran or aHadith might have to say.

Why apart from that? LOL :rollseyes

[IceQueen~]

However, why do you think that we are smaller than our ancestors? Apart, of course, from anything the Quran or aHadith might have to say.

apart from the Quran and hadith there is evidence of huge ancient graves for really large bodies etc.

[HeiGou]

You are speaking of the similarities again, this is no proof that one came from the other.

I agree it is not proof that one came from another. Admittedly I think it is a first step to accepting that one came from another. But it is your mockery of the idea we are related to the great apes that is the issue at the moment. People like mocking monkeys for some reason I do not understand. Even if you do not accept evolution we are obviously related and I for one am proud to be related to gorillas.

as for fossils chek this out:

[indent]THE FOSSIL RECORD DENIES THE THEORY OF EVOLUTION

^^The theory of evolution maintains that different groups of living things (phyla) developed from a common ancestor and grew apart with the passing of time. The diagram left states this claim: According to Darwinism, living things grew apart from one another like the branches on a tree.

>sigh< The theory of evolution does make that claim. In general terms. But there is no reason to think it has to occur exactly as that graph shows it. It does not appear in Darwin's work after all.

But the fossil record shows just the opposite. As can be seen from the diagram left, different groups of living things emerged suddenly with their different structures. Some 100 phyla suddenly emerged in the Cambrian Age. Subsequently, the number of these fell rather than rose (because some phyla became extinct).

Indeed. Biologists talk of the Cambrian Explosion for that reason. But notice these are phyla - not species as such. That is, they are taking the larger groups of species, and not comparing the number of species per se. A phyla might have one member. It might have a hundred thousand. They are poor measures of diversity.

Before then, there is no trace in the fossil record of anything apart from single-celled creatures and a few very primitive multicellular ones. All animal phyla emerged completely formed and all at once, in the very short period of time represented by the Cambrian explosion. (Five million years is a very short time in geological terms!)

Indeed it is. The Cambrian explosion is interesting for that reason and it is not yet fully explored. But you have to remember a few things: 1. There fossil record is incomplete. Because we have not found a fossil from before the Cambrian, it does not mean that they did not exist and 2. classification of phyla and even species is a controversial issue. They are to some extent artificial and dependent on what scientists think. They also start in the present and grow back. You might reclassify some of those fossils and change the whole way you look at the Cambrian. People argue over how to classify fossils all the time and the Cambrian is no exception.

The fossils found in Cambrian rocks belong to very different creatures, such as snails, trilobites, sponges, jellyfish, starfish, shellfish, etc. Most of the creatures in this layer have complex systems and advanced structures, such as eyes, gills, and circulatory systems, exactly the same as those in modern specimens. These structures are at one and the same time very advanced, and very different.

Indeed. It is amazing. However it is not proof that evolution is wrong.

Richard Monastersky, a staff writer at ScienceNews magazine states the following about the "Cambrian explosion," which is a deathtrap for evolutionary theory:

A half-billion years ago, ...the remarkably complex forms of animals we see today suddenly appeared. This moment, right at the start of Earth's Cambrian Period, some 550 million years ago, marks the evolutionary explosion that filled the seas with the world's first complex creatures.57

Notice the dishonesty with which this website takes a claim by a scientist and subtly claims that it says something it does not - where does Monastersky claim that the Cambrian is a deathtrap for evolution?

The same article also quotes Jan Bergstr&#246;m, a paleontologist who studied the early Cambrian deposits in Chengjiang, China, as saying, "The Chengyiang fauna demonstrates that the large animal phyla of today were present already in the early Cambrian and that they were as distinct from each other as they are today."58

Which is interesting but again irrelevant unless the authors of that website are asserting he is claiming something he is not.

This illustration portrays living things with complex structures from the Cambrian Age. The emergence of such different creatures with no preceding ancestors completely invalidates Darwinist theory.

No it does not actually because of course they had preceeding ancestors.

And lastly chek this:

Phillip Johnson, a professor at the University of California at Berkeley who is also one of the world's foremost critics of Darwinism,

What you fail to mention is that Professor Johnson is a professor in Law. Not biology. Now some people might think that was relevant. Do you?

describes the contradiction between this paleontological truth and Darwinism:

Darwinian theory predicts a "cone of increasing diversity," as the first living organism, or first animal species, gradually and continually diversified to create the higher levels of taxonomic order. The animal fossil record more resembles such a cone turned upside down, with the phyla present at the start and thereafter decreasing.60

Darwinism does not insist on a perfectly symmetrical, smooth, cone. Nor is measurement by phyla necessarily the best way to measure diversity.

Hope that clears up the fossil business :)

Try it on a species basis, not a phyla basis.

Isn't it interesting that Muslims rely so heavily on Christians to "refute" Darwinism? It really brings home to me how knowledge-poor the Muslim world is. I was expecting an Islam-based school of anti-science, but instead all I find is recycled Christian apologetics. It is not just that there are almost no Muslim scientists of note, and unfortunately there are so very few, it is that there are no Muslims who reject science who are capable of doing so in an informed and knowledgeable way. It is an amazing indictment of the Muslim education systems of the world.

[HeiGou]

Why apart from that? LOL :rollseyes

Because you will believe that to be true and there is no point arguing about it.

What other evidence is there?

[IceQueen~]

Because you will believe that to be true and there is no point arguing about it.

What other evidence is there?

well said-you're learning:)

[IbnAbdulHakim]

lol heigou i gotta hand it 2 u ur one tough nut to crak ;) ;)

[...]

lol heigou i gotta hand it 2 u ur one tough nut to crak ;) ;)

:giggling: ;D :giggling: SO true!

[------]

lol heigou i gotta hand it 2 u ur one tough nut to crak ;) ;)

Lolllllllllllllllll akheeeeeeeeeeeeee ;D

[root]

WE ARE SAYING, THAT DARWIN DID NOT AGREE WITH HIS OWN THEORY, WE DON'T WANT YOU TO JUSTIFY THE PROBLEMS OF THE THEORY FOR US.

Your starting from a flawed premis, Darwin acknowledged his own concerns for the theory concerns of which modern science today is able to resolve. if you think this means he created his theory and then invalidated it you are nuts.

A quick example would be a recent new study that supports natural selection (Darwins favoured mechanism for evolution) is a driving force behind evolution:

http://www.pnas.org/cgi/reprint/0508653103v1

[HeiGou]

lol heigou i gotta hand it 2 u ur one tough nut to crak ;) ;)

That because you all evolved from monkeys. I evolved from horseshoe crabs. Tough shells you know. If you weren't so squishy on the outside, you'd be tough too.

Power to Arthropods! Death to Invertebrates! Boil anyone with a backbone - see if they like it!

[IceQueen~]

That because you all evolved from monkeys. I evolved from horseshoe crabs. Tough shells you know. If you weren't so squishy on the outside, you'd be tough too.

Power to Arthropods! Death to Invertebrates! Boil anyone with a backbone - see if they like it!

LOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOL!!!!;D :giggling:

[root]

Cambrian Explosion

Complex life forms appear suddenly in the Cambrian explosion, with no ancestral fossils.

The Cambrian explosion was the seemingly sudden appearance of a variety of complex animals about 540 million years ago (Mya), but it was not the origin of complex life. Evidence of multicellular life from about 590 and 560 Mya appears in the Doushantuo Formation in China (Chen et al. 2000, 2004), and diverse fossil forms occurred before 555 Mya (Martin et al. 2000). (The Cambrian began 543 Mya., and the Cambrian explosion is considered by many to start with the first trilobites, about 530 Mya.) Testate amoebae are known from about 750 Mya (Porter and Knoll 2000). There are tracelike fossils more than 1,200 Mya in the Stirling Range Formation of Australia (Rasmussen et al. 2002). Eukaryotes (which have relatively complex cells) may have arisen 2,700 Mya, according to fossil chemical evidence (Brocks et al. 1999). Fossil microorganisms have been found from 3,465 Mya (Schopf 1993). There is isotopic evidence of sulfur-reducing bacteria from 3,470 Mya (Shen et al. 2001) and possible evidence of microbial etching of volcanic glass from 3,480 Mya (Furnes et al. 2004).


There are transitional fossils within the Cambrian explosion fossils. For example, there are lobopods (basically worms with legs) which are intermediate between arthropods and worms (Conway Morris 1998).

Only some phyla appear in the Cambrian explosion. In particular, all plants postdate the Cambrian, and flowering plants, by far the dominant form of land life today, only appeared about 140 Mya (Brown 1999).

Even among animals, not all types appear in the Cambrian. Cnidarians, sponges, and probably other phyla appeared before the Cambrian. Molecular evidence shows that at least six animal phyla are Precambrian (Wang et al. 1999). Bryozoans appear first in the Ordovician. Many other soft-bodied phyla do not appear in the fossil record until much later. Although many new animal forms appeared during the Cambrian, not all did. According to one reference (Collins 1994), eleven of thirty-two metazoan phyla appear during the Cambrian, one appears Precambrian, eight after the Cambrian, and twelve have no fossil record.

And that just considers phyla. Almost none of the animal groups that people think of as groups, such as mammals, reptiles, birds, insects, and spiders, appeared in the Cambrian. The fish that appeared in the Cambrian was unlike any fish alive today.

The length of the Cambrian explosion is ambiguous and uncertain, but five to ten million years is a reasonable estimate; some say the explosion spans forty million years or more, starting about 553 million years ago. Even the shortest estimate of five million years is hardly sudden.

There are some plausible explanations for why diversification may have been relatively sudden:

The evolution of active predators in the late Precambrian likely spurred the coevolution of hard parts on other animals. These hard parts fossilize much more easily than the previous soft-bodied animals, leading to many more fossils but not necessarily more animals.

Early complex animals may have been nearly microscopic. Apparent fossil animals smaller than 0.2 mm have been found in the Doushantuo Formation, China, forty to fifty-five million years before the Cambrian (Chen et al. 2004). Much of the early evolution could have simply been too small to see.

The earth was just coming out of a global ice age at the beginning of the Cambrian (Hoffman 1998; Kerr 2000). A "snowball earth" before the Cambrian explosion may have hindered development of complexity or kept populations down so that fossils would be too rare to expect to find today. The more favorable environment after the snowball earth would have opened new niches for life to evolve into.

Hox genes, which control much of an animal's basic body plan, were likely first evolving around that time. Development of these genes might have just then allowed the raw materials for body plans to diversify (Carroll 1997).

Atmospheric oxygen may have increased at the start of the Cambrian (Canfield and Teske 1996; Logan et al. 1995; Thomas 1997).

Planktonic grazers began producing fecal pellets that fell to the bottom of the ocean rapidly, profoundly changing the ocean state, especially its oxygenation (Logan et al. 1995).

Unusual amounts of phosphate were deposited in shallow seas at the start of the Cambrian (Cook and Shergold 1986; Lipps and Signor 1992).

Cambrian life was still unlike almost everything alive today. Using number of cell types as a measure of complexity, we see that complexity has been increasing more or less constantly since the beginning of the Cambrian (Valentine et al. 1994).

Major radiations of life forms have occurred at other times, too. One of the most extensive diversifications of life occurred in the Ordovician, for example (Miller 1997).

[IceQueen~]

why don't you guys all go read here: http://www.harunyahya.com/c_refutation_darwinism.php
when you've finished you can come back and argue then...:X

[IbnAbdulHakim]

That because you all evolved from monkeys. I evolved from horseshoe crabs. Tough shells you know. If you weren't so squishy on the outside, you'd be tough too.

Power to Arthropods! Death to Invertebrates! Boil anyone with a backbone - see if they like it!

lol wat the? no more redbull 4 u!!!

[IceQueen~]

hey-evryone-check out this website: http://www.thestoneage.org/
really good info masha allah

[root]

http://www.thestoneage.org/

His pen-name, Harun Yahya, is formed from the names "Harun" (Aaron) and "Yahya" (John) in the esteemed memory of the two Prophets who struggled against infidelity.

Many works of Harun Yahya are being currently translated into English, French, German, Italian, Russian, Spanish, Arabic, Portuguese, Albanian, Serbo-Croat (Bosnian), Polish, Urdu, Indonesian, Kazakh, Azeri, Malay and Malayalam. The target is to translate all books into English and many other languages in the near future, and thus to make them available for the benefit of all people.

The common point in all the writer's works is that all the topics covered by his works are in full agreement with the Qur'an, and strongly affirmed by Qur'anic understanding. Even the topics addressed by science and mostly considered complicated and confusing are narrated very lucidly and explicitly in the books of Harun Yahya. For this reason, these books appeal to everyone, from every age and social group.

[Ayesha Rana]

Isn't it interesting that Muslims rely so heavily on Christians to "refute" Darwinism? It really brings home to me how knowledge-poor the Muslim world is. I was expecting an Islam-based school of anti-science, but instead all I find is recycled Christian apologetics. It is not just that there are almost no Muslim scientists of note, and unfortunately there are so very few, it is that there are no Muslims who reject science who are capable of doing so in an informed and knowledgeable way. It is an amazing indictment of the Muslim education systems of the world.

Have you checked out the website Marge1 put up?
We have loads of people to rely on and Harun Yahya is one of them. Just cos someone gives an example of a Christian it doesn't mean we can't live without him/her, it just backs up our claim by using another religion so you know that muslims arn't the only ones who Disagree with Darwin in that way. There is no reason why we shouldn't respect and accept the opinion of a Christian after all it is the closest religion to Islam.

[Soldier2000]

To all the atheist on this forum

Does Science disprove the existance of God?

[HeiGou]

Have you checked out the website Marge1 put up?

I have some experience of HY's works although I can't claim to have read them all. Or even that many.

We have loads of people to rely on and Harun Yahya is one of them. Just cos someone gives an example of a Christian it doesn't mean we can't live without him/her, it just backs up our claim by using another religion so you know that muslims arn't the only ones who Disagree with Darwin in that way. There is no reason why we shouldn't respect and accept the opinion of a Christian after all it is the closest religion to Islam.

I suspect Judaism is a lot closer to Islam than Christianity. But it is not important. The question is whether HY is relying on re-hashed Christian apologetics or whether he has done his own research. It is an interesting question because you would expect science and Islam to clash in other places as well. Does anyone know of any other issue where Islam and scientists have profound disagreements? Evolution is almost the last issue Christians are willing to fight on. So does Islam have its own tradition of disagreement? Presumably a lot of historical and archaeology so let's not count those.

[HeiGou]

does science disprove the existance of God?

Not that I know of. Do many scientists argue that science can remove the need to rely on God for explanations about the natural world?

[Soldier2000]

Not that I know of. Do many scientists argue that science can remove the need to rely on God for explanations about the natural world?

then how can you be so sure that God does not exist?

[root]

does science disprove the existance of God?

The scientific data does not support the existence of God.

then how can you be so sure that God does not exist?

Only religion offers absolute proof which is not supported by mainstream scientific data.

[Ayesha Rana]

Not that I know of. Do many scientists argue that science can remove the need to rely on God for explanations about the natural world?

Well, many scientists start believing in God when they realize how complex and detailed everything is so at first probably but when they start reasearching more deeply they change their minds.
By the way are you an Atheist? cos that post was addressed to atheists.

[IbnAbdulHakim]

Well, many scientists start believing in God when they realize how complex and detailed everything is so at first probably but when they start reasearching more deeply they change their minds.
By the way are you an Atheist? cos that post was addressed to atheists.

:sl:

Hei-gou is an atheist but mashAllah he seems so openminded.I've started making dua that he actually enters islam one day, i think its more then possible :). May Allah give hei-gou hidayyat inshaAllah!!! ameen.

:w:

[...]

:sl:

Hei-gou is an atheist but mashAllah he seems so openminded.I've started making dua that he actually enters islam one day, i think its more then possible :). May Allah give hei-gou hidayyat inshaAllah!!! ameen.

:w:

Ameen

[...]

Not that I know of. Do many scientists argue that science can remove the need to rely on God for explanations about the natural world?

Actually, how many times have u noticed that scientists are WRONG, and that they keep changing their opinions, whereas the Quran is fixed and is always right.:)

[root]

Actually, how many times have u noticed that scientists are WRONG, and that they keep changing their opinions, whereas the Quran is fixed and is always right.

That's because religion tries to offer absolute proof and science can never give an absolute proof. take gravity for example, being falsifiable and subject to change as we disover more about the natural world, theory of gravity is subject to change.

[IbnAbdulHakim]

That's because religion tries to offer absolute proof and science can never give an absolute proof. take gravity for example, being falsifiable and subject to change as we disover more about the natural world, theory of gravity is subject to change.

:peace: peace

That is quite interesting. So your saying you think people have not fully understood the law of gravity yet?

:peace: peace :)

[czgibson]

Greetings,

----

----

Now if you JUST ONCE read the lame logics he has provided, you'll realize theses people are not worth debating with. Even if my grandma would have read, even she would have realized it.

Here's just a small sample of the insults this new member has decided to fling in the general direction of atheists.

Does anyone think he's doing his cause any favours with this debating style of denial and aggression?

Peace

[IbnAbdulHakim]

:peace: peace

That is quite interesting. So your saying you think people have not fully understood the law of gravity yet?

:peace: peace :)

:peace:

A responce to this would be appreciated :)

:peace:

[HeiGou]

Actually, how many times have u noticed that scientists are WRONG, and that they keep changing their opinions, whereas the Quran is fixed and is always right.:)

How many times have you noticed that scientists are right and they have solved problems? Science is not infallible and does not always get things right, but it moves in the general direction of "more rightness" all the time. Look at medicine and airplanes for example. How many lives have scientists saved with modern medicine? A colleague of mine over the weekend had to go to hospital with blood poisoning from an infected wound. 50 years ago she would have died. Whatever cheap shots you make at scientists for being wrong from time to time, the fact is science works and it works reliably. So when you're sick are you going to trust your doctors?

[HeiGou]

That is quite interesting. So your saying you think people have not fully understood the law of gravity yet?

I am not Root, but yes. People have not yet understood gravity yet. Gravity is one of the four fundamental forces in physics. There are questions about how they arise, how they work, and how they are related to each other. Quantum physics, for instance, proposes a "graviton" like a photon but for gravity. WE know next to nothing about gravitation radiation for instance. A lot of work needs to be done yet.

[HeiGou]

then how can you be so sure that God does not exist?

I am not sure He does not. I am not a strong atheist. But I am not convinced that the God of the Quran exists either. Why do you think He does?

[root]

That is quite interesting. So your saying you think people have not fully understood the law of gravity yet?

Yes, that is exactly what I am saying. The theory of general relativity is as falsifiable as any other theory such as evolution and it is currently being challenged as new scientific discoveries are made.

[HeiGou]

Well, many scientists start believing in God when they realize how complex and detailed everything is so at first probably but when they start reasearching more deeply they change their minds.

Actually it tends to be the other way around. Atheism is strongly associated with scientific knowledge. At least in the West. Illiterates nearly always believe in some sort of Supernatural Being, usually some form of animism. Admittedly Islam, like Judaism and some forms of Protestantism, is strongly associated with literacy, but I doubt that the rule is that different in Islam.

By the way are you an Atheist? cos that post was addressed to atheists.

I am less than comfortable with being described as an atheist. But I guess I am close enough.

[HeiGou]

Ameen

I thank you both. That is very generous of you. As any post may be my last post, and this one may well be, I wouldn't want to go without saying I really do appreciate the intention behind that.

[PrIM3]

well-- I am not a scholor in science or anything like that... I think hand and hand science and religion work together.. but then again some things don't..

there are some things that I might see that will lead me to believe that the visible things in this world speaks more of the invisible things of the other world which lead me to believe that there as to be a higher being.. but that isn't going to cause you to believe in God or any other being in that matter.
I believe its more on the will of the person rather than arguements and arguements at a time... trying to force someone to believe in something is well wrong..
the atheist on this forum seem to be here to give incite on why they believe on what they believe in...

as everyone else who are not muslim..

so when it comes down to it, it is the matter of the will of the person

[Muhammad]

Greetings,

Here's just a small sample of the insults this new member has decided to fling in the general direction of atheists.

Does anyone think he's doing his cause any favours with this debating style of denial and aggression?

I have warned the member for his insults and removed the offensive material. I agree that being respectful is very important.

And for the record, I have replied to your last post (in case it was missed) :)

Peace.

[IbnAbdulHakim]

I am less than comfortable with being described as an atheist. But I guess I am close enough.

:peace:

Really well im sry for thinking of you in such a manner, please let me know what you are comfortable with :).

I see, thats very interesting, about gravity thanks for both inputs. But still nothing in the Quran has ever been proven false :) and that way it shall surely stay.

:peace:

[IceQueen~]

:peace:



I see, thats very interesting, about gravity thanks for both inputs. But still nothing in the Quran has ever been proven false :) and that way it shall surely stay.

:peace:

yeah- please go read some miracles of the quran first heigou and then see how science is not related to God.

[Ayesha Rana]

Is it just me Marge1 or does the URL come up every time you post something.

Yeah what about the stages of the baby when it is growing inside the mother?

[IceQueen~]

Is it just me Marge1 or does the URL come up every time you post something.

Yeah what about the stages of the baby when it is growing inside the mother?

yup, yup-how did the quran know that 1427 yrs ago?! they did not have the technology back then..

[Ayesha Rana]

Haha! Marge is jinxed.
Y'know i once told my teacher that and she said that they killed women and opened them up to see what the embryo looked like. Talk about Narrow minded! They didn't even have microscopes.

[...]

I thank you both. That is very generous of you. As any post may be my last post, and this one may well be, I wouldn't want to go without saying I really do appreciate the intention behind that.

No probs:peace: :thankyou:

[IceQueen~]

Ameen

thumma ameen!:)

[HeiGou]

Yeah what about the stages of the baby when it is growing inside the mother?

I am deeply unconvinced about the embryology of the Quran. But look at what the Greeks knew. Spotaneous abortions are not uncommon. Presumably most people had a fair idea of what the stages of a baby inside the Mother looked like.

[...]

I am deeply unconvinced about the embryology of the Quran. But look at what the Greeks knew. Spotaneous abortions are not uncommon. Presumably most people had a fair idea of what the stages of a baby inside the Mother looked like.

What did the greeks know?:?

[Ayesha Rana]

I am deeply unconvinced about the embryology of the Quran. But look at what the Greeks knew. Spotaneous abortions are not uncommon. Presumably most people had a fair idea of what the stages of a baby inside the Mother looked like.

Yeah but this isn't the kind of idea you can just guess. How are they supposed to know exacltly and in precise detail what the embryo looks like and what develops first?

And when was it that the Greeks found out what they knew?

[czgibson]

Greetings,

yup, yup-how did the quran know that 1427 yrs ago?! they did not have the technology back then..

I've asked this question many times before, but no-one has yet answered it:

Two ancient Greeks, Democritus and Aristarchus had scientific theories that were either ignored or rejected for centuries before science actually discovered them to be accurate. Democritus proposed an atomic theory of matter, and Aristarchus believed that the Earth revolved around the sun, and not the other way round. These statements are recorded in texts from centuries before the time of the Jesus, let alone the invention of telescopes and microscopes.

Does the fact that these two men were right make their pronouncements miraculous?

Peace

[czgibson]

Greetings Muhammad,

Sorry, I must have missed this post - thank you for the reminder. :)

Firstly, not everyone undertakes the search for God with the same level of scrutiny and sincerity as others. Not everyone bothers to find out about these things in the first place, so in this way, many people do not believe in God upon grounds that don't have anything to do with proof.

I agree. I'm not saying "I don't believe in god because there is no proof that he exists", I'm just questioning the assertion that god's existence has been proven.

As for the evidence for the existence of God, then at first it might seem like there could be various possibilities, just like there could be for finding the third side of a triangle had Pythagoras' Theorem not been discovered. Upon examining the evidience though, other possibilities are ruled out and a final conclusion can be drawn.

I'm not so sure. It takes an awful lot of confidence to say that you know where the universe came from. I don't have that confidence, and neither do most scientists and philosophers. Where there is a lack of evidence, we should say that we simply don't know, rather than ruling out all other possibilities that don't fit with our hypothesis.

There is also another factor that comes to mind, explaining why not everyone shares the same belief in God, and that is denial. For some who realise that there is a God, and understand the evidence that points to Him, desire and personal aims hold them back. Perhaps it is upholding a family tradition or fear of surrounding reaction; many things such as this act to create denial in people's hearts. Ultimately, guidance is from God Himself and we can only pray for the misguided.

I suppose that's possible, if someone was raised in a strongly atheist family or something. I've not heard of such a case outside of Communist dicatatorships, though.

In my own case, it would have been easier for me if I had believed in god - all those hours spent in church at my (Catholic) school wouldn't have seemed like such a monumental waste of time.

However, we have not begun to consider what the proofs of the existence of God are, so we cannot really compare them to Pythagoras' Theorem.

That's not what I'm doing. I'm comparing them to the proof of Pythagoras' Theorem.

Also, I think most of the standard arguments for god's existence have been covered on this and various other threads, haven't they?

I'm not going to locate them all now, but I'm sure we've had discussions on the cosmological (first cause) argument, the teleological (design) argument, the Qur'anic miracles arguments and the argument from morality. The ontological argument hasn't made an appearance, as far as I recall. Are these the "proofs" you're thinking of? If you'd like to mention some that aren't covered in this list I'd be happy to discuss them.

Furthermore, this likening of the proofs of God's existence to science/mathematics relates back to my point that such a comparison isn't always necessary.

I'm not saying it's necessary, but is it somehow unacceptable?

For example, Pythagoras' Theorem is like a rule by which this universe is governed, like gravity. If we look at how these rules came about and ponder over their regulation, we are viewing the matter in a different way while still using logic and open to being compelled to accept a true answer.

I'm afraid I'm not really sure what you're getting at here - would you mind elaborating?

Peace

[Muhammad Waqqas]

... Considering your youthful age and lack of any basic ...

You should rather have written "Assuming" instead of "Considering".

Anyway, here are the extremely logical replies brother HeiGou has written in reply to my post. And yes, I indeed should not have been that much offensive. I'm sorry.

So here we are:

1) You can say that all you like but it will not become any more true through repetition. Darwin did believe in his theory and went to his grave defending it. (Extremely logical, backed up by facts and quoted from books)

2) Well nothing more is needed. You say we do not find intermediaries and we do. Simple. (Extremely logical, backed up by facts and quoted from books)

Next,

This is not true as Westerners have been able to build much better lenses for some time.

Which reflects extreme deficiency of knowledge in the writer's part. You are actually living in 1850's and don't want to come to modern age, for you'll have to accept God. Closing your eye's to reality cannot cure you from any disease.

With some other form of eye perhaps? Come on, this is childish.

Just because you cannot understand something doesn’t mean that thing is childish. I was referring to the comparison of natural eye with human-made technology, the TV, the monitors, the LCDs etc.

All this nonsense has nothing to do with evolution of course. And if you thought about it for a minute you would realize that computer monitors are above all else, cheap and so their quality tends to be poor - but they are getting better.

Again, if you cannot understand something, doesn’t mean the thing is wrong.
It has alot to do with evolution. By writing that, I was replying to "YOUR" argument, which you made in the state of mind of a person from 19th Century. That is:

Well yes it is possible as Darwin agreed. And as study of the eye shows, it proves evolution because it is not a wonderful structure but a messy, poorly designed organ that clearly evolved.

And that reflects complete illogicalness and lack of knowledge of the writer. And so I had replied that it’s not that much of a simple structure (the eye) its way more complicated.

Yet Americans can build satellites that can read number plates from outer space. And in 3-D too. So self evidently, scientists can build better lenses than the human eye. Is this the best you can do?

This is not true as Westerners have been able to build much better lenses for some time.

It’s like we dreaming right now. How many people write posts while they are asleep? Have you ever seen an image, taken or recorded from such a camera, which is so vivid and clear and sharp that you cannot differentiate whether it’s an image on a screen or is it a real thing? The brief answer is: “NO”, and by all means its impossible to do it. If yet this sharpness is not achieved, after which hundreds and thousands of people are working on, then how can you imagine that the eye came into existence just coincidently? Its illogical.

First of all, I did not talk about the range of eye to be compared with satellite. I wrote about the sharpness of image. No matter how advanced Television you have, you can clearly differentiate between the image on the TV and a real object. So therefore, with all the technology science has got, yet you cannot have anything like the natural eye.

Next, seeing through a long distance too doesn’t prove any superiority of anything. A simple computer can solve a thousand calculations in an instant, that doesn’t mean its more intelligent than a human? A human might be able to solve only one at a time, but the difference is the power of decision. This is what the computer cannot take. Therefore seeing far-away and calculating faster doesn’t prove anything.

You know, if you go back in time, you'll see that the creation of satellite is not a coincidence. Ever since man has set foot on the earth, he is doing a research. Therefore, everything we have today, is actually a research work of, perhaps, 1 Million years? If the eye you are referring to (The satellite etc) is created in this much span of time, with countless number of people involved in it, how can you assume the real eye be created just coincidently?!?

Same old argument - "I am too stupid to think of how this might have occurred therefore it is the work of God". And it is just as wrong now as it ever has been. Eyes do not evolve purely through chance. Eyes evolve through evolution which is, locally, directed. Not random.

This is technically the end of the discussion. What are we discussing? It’s exactly what you wrote but in an ironic way.

Science accepts logics and reasons. Today, after advancement of science we know the deep structure of Human, we know its miraculous, and its unimaginable and illogical to think its evolved. And that’s exactly what you stated above. Since it’s unimaginable, and illogical, therefore we reject it. How easier do you want it to be?

How did the cell feel the need of seeing? How? And how come everything, ever since they have started to evolve contains eyes? It should have been so for some species. Such wonderful tool should have evolved way later in the span of time. Earlier shapes of the living thing shouldn’t have had such things.

So ask the tough question about the eye - the light coems in through the lens ... Why else would the eye be back to front?

You're living in 19th century, like I said, closing your eyes to reality will do nothing at all.

I already wrote above, that the image formed by the eye is way much sharper than any other image formed by any LCD or anything. This is a sufficient proof that the eye is much more superior to anything else available today.

Another super logical post:

who asked you to clear the problems in the theory for us? ...

You did. You are wrong if you say Darwin did not agree.

and..

Please do not feel you need to.

...imagine. He is trying to be more reasonable and logical here.

How about S&#225;lim Ali, born S&#225;lim Moizuddin Abdul Ali, (November 12, 1896 - July 27, 1987), Stanley Cohen (born November 17, 1922) as for christians, take your pick.

How many people know about Salim Ali? How many? He forgot to mention that he was an Indian. Who knows about Stanley Cohen? Who? Anybody here? Raise your hands. Are these people worth mentioning? Its like I say, oh my neighbor, he disagrees with gravity, therefore we have scientists who disagree with gravity and that’s why, gravity is a conflicting theory.

Stephen Jay Gould. Richard Dawkins. You name one. Which biologists do not is the more relevant question.

If you would have “JUST READ” my post, you could have pointed out at least 3 – 5 biologists who disagreed with Darwin.

1) Patrick Glynn
2) Bryce Christensen
3) George Politzer
4) Henry Margenau
5) John Maddox
6) H. P. Lipson
7) Paul Davies
8) W. Press
9) And last, but not least: “Charles Darwin.”

You just keep counting them and the list won’t end.

Why don't you look up what that article says and get back to me?

Well that is not quite a fair claim about what he said. Again why don't you read it and get back to us?

Sure. What is called Punk-Ek. But still Darwinian. You cannot take a quote out of context and claim it is a refutation of Darwinism when it is the opposite.

Oh My! There we have it again. Another self assumption, backed up with NO FACT at all. Every brief quote needs not to be a quote out of context. You are assuming your self that it’s out of context and with context it will mean something else. Why don’t you just prove it wrong? And while you can’t, you’re on the wrong side. I’ve given a quotation with page number, all you have to do is go and get the book and read the context, and then tell everybody what the real context is. Since you’re not doing it, you’re not right. Your argument means nothing to anybody. When you will have it done, when you will have it proved, only then your this argument may hold some weight.

Secondly, I need not to prove anything to you. I am not here to make you a God-Believing or a Muslim. Seriously, I don’t give a damn about it. My job is only to show you the truth, you agree with it, well and good, you don’t, I don’t care at all. I’m never going to worship my self (by following my emotions) and neither are you going to worship that which I worship, nor will I worship that which you worshiping, nor will you worship that which I worship. For you is your way, for me is mine.

No one had defend Spontaneous Generation for about 200 years when Darwin came along. It had been proven wrong with the first microscopes. It has nothing to do with Darwin at all - who did not, by the way, comment much on the origins of life.

Why do atheists have no problem in lying? The first microscope was invented by Hans and Zacharias Jansen, a father and son who operated a Dutch lens grinding business, around 1595. Their first microscopes were more of a novelty than a scientific tool since maximum magnification was only around 9X and the images were somewhat blurry. You expect them to prove SG wrong with this:

?!? Are you awake?!?

It was Antony Van Leeuwenhoek, a Dutch draper and scientist, and one of the pioneers of microscopy who in the late 17th century became the first man to make and use a real microscope. He made his own simple microscopes, which had a single lens and were hand-held. Van Leeuwenhoek outdid his contemporaries by developing ways to make superior lenses, grinding and polishing a small glass ball into a lens with a magnification of 270X.

All the early microscopes saw quite distorted images due to the low quality of the glass and imperfect shape of their lenses. The 19th century saw dramatic progress in the development of the microscope, thanks to the contributions of Carl Zeiss, who devoted significant effort to the manufacture of microscopes, Ernst Abbe, who carried out a theoretical study of optical principles, and Otto Schott, who conducted research on optical glass.

(Source: http://www.visioneng.com/technology/...r_developments)

Let me quote… Blah blah blah

Imagine, no reference at all, who are you quoting? Again your neighbor?

Point # 1: There was no such microscope with which they might have proven SG wrong.

Point # 2: I gave a reference Louis’s book, which he wrote 5 years after Darwin’s book, which is quite convincing, since why would Louis do a research on something that has already been proved? It’s illogical. Come up with facts.

Just look at his microscope is used to see micro-organisms:

Got anything?

Did his post had anything?!? How many refrences? Not a single! How many logical arguments? Not a single. Yet, he dares to write the ending line “Got anything”, imagine…

[Muhammad Waqqas]

Do you doubt that if the slow deer are eaten the faster deer will survive and so over time the deer herd will become faster?

Now look at this... WHY DON’T YOU PEOPLE BE A BIT MORE PRACTICLE? We have marathon runners, don’t we? Are their children by birth fast in running? NO! Therefore natural selection is nothing to do with evolution.

And that "unquestionable" shows the stupidity of the author and of course no one says deer will become horses. They may, however, become something else.

Yea right, because horses were actually evolved from crabs, right? How stupid can an atheist be? Of course horses, according to Charles Darwin, are a modified form of dears and goats.

Which is perfectly true and utterly irrelevant to your claims above. It is clear that variation in deer does occur - some are faster than others, no two looks exactly alike.

I sometimes ask my self, why do I talk with atheists… but then I realize that its my job at least to tell them once that there is a life after death waiting for you, and so I continue doing it.

Did you actually read what I wrote? “Natural selection can do nothing until favourable individual differences or variations occur.”

INDIVIDUAL DIFFERENCES OR VARIATIONS OCCUR. Meaning on individual bases, there might be some changes, but on the whole race of the specie there won’t be an effect. Therefore the animal will not evolve any more. What the …. Confuses you?

This is utterly ignorant. Darwin rejected Lamarckian theories. There is no point attempting to claim that Darwin was a Lamarkian when he was not. It is in fact amazing that Darwin, without understanding genetics, nonetheless did a verty good job of working out how it all worked. DNA simply proves Darwin right. AS you would know if you had done as much as High School biology.

DNA doesn’t. Who are you fooling? Now, I know you were thinking of writing down a few more lies about DNA as well, but you stoped for you thought there might be some who may take it out and you may be ashamed. I read a post by root a few pages back, completely ridiculous. You tell us about DNA, how dose it prove. And then wait for the reply.

[Muhammad Waqqas]

I am deeply unconvinced about the embryology of the Quran. But look at what the Greeks knew. Spotaneous abortions are not uncommon. Presumably most people had a fair idea of what the stages of a baby inside the Mother looked like.

There were a group of Arabs who collected the data dealing in the Qur’an about ‘Embryology’ and the Hadith dealing with Embryology. And they presented it to Professor Keith Moore, who was the chairman and the head of the department of ‘Anatomy’, in the university of Toronto, in Canada - And at present he is one of the leading scientist in the field of ‘Embryology.’ After reading the various translations of the Qur’an, he was asked to comment, and he said… ‘Most of the Verses of the Qur’an and the Hadith, are in perfect conformity with Modern Embryology. But there are a few Verses which I cannot say that they are right neither can I say that they are wrong, because I myself don’t know about it. And two such Verses were the first two Verses of the Qur’an to be revealed, from Surah Iqra or Surah Alaq , Ch. 96 Verses No. 1 and 2 which says…‘Read, recite or proclaim in the name of thy Lord, Who created, Who created the human beings from something which clings - a leech like substance.'

So professor Keith Moore said, ‘I did not know whether the early stage of the embryo looks like a leech’ And he went into his laboratory, and he analyzed the early stage of an embryo, under a microscope and compared it with the photograph of a leech, and he was astonished at the striking resemblance.

Professor Keith Moore, after about 80 questions were asked to him, he said… ‘If you would have asked me these 80 questions, 30 years ago, I would not be able to answer more than 50 percent - Because embryology has developed recently in the past 30 years.’ He said this in the eighties. Now, do we believe Dr. Keith Moore whose statement is available outside in the foyer - his videocassette is available… ‘This is the truth’...’Anna-ul-Haq’... recorded statement.

Will you believe HeiGou's personal opinion, or the one mentioned in this book, with Islamic edition as well as the photograph? And in the videocassette available outside you can see it - He makes those statements. So you have to choose which is more logical - Personal opinion of GeiGou, or Keith Moore's statement on Video.

It was incorporated later into this book…‘The Developing Human’ - the 3rd edition and this book got an award for the best medical book written by a single author in that year. It's Islamic edition that was put forward by Shaikh Abdul Majeed Al-Jindani and certified by Keith Moore himself. The Qur’an says in Surah Muminun, Ch. 23 Verse No. 13, and Surah Haj Ch. 22, Verse No. 5, and no less than 11 different places in the Qur’an, that the human beings have been made from a ‘nutfaa’ ‘minute quantity of liquid’…like a trickle that is remaining in the cup. ‘Nutfa’ in Arabic… a very small quantity. Today we have come to know, that in one seminal emission, in which there are several millions of sperms, only one is required to fertilize the ovum - ‘The Qur’an refers as ‘nutfa.’ Qur’an says in Surah Sajda Ch. 32 Verse no. 8…‘We have created the human beings from ‘Sulalah’ - That means the best part of a whole. The one sperm which fertilizes the ova out of the millions of sperms, the Qur’an refers to as ‘Sulalah’…‘best part of the whole.’ And Qur’an says in Surah Insan, Ch. 76 Verse No. 2…‘We have created the human beings from ‘nutfatunamshaj’…a minute quantity of mingled fluid’ - referring to the sperm as well as the ovum - Both are required for the fertilization. It is mentioned in Surah Muminun Ch. 23, Verses No. 12 to 14 - The translation is that…‘We have created the human beings from a ‘nutfa.’ – ‘A minute quantity of liquid.’ Then placed it in ‘cararemakeen’ - a place of security. Then We made it into an ‘Alaqa’ - a leech like substance - something which clings - a congealed clot of blood. Then We made that ‘Alaqa’ into a ‘Mutga’ a ‘chewed like lump.’ Then We made the ‘Mutga’ into ‘Izama’…bones. Then clothed the bones with ‘leham’… flesh. Then We made it a new creature. Blessed be Allah Who is the best to create. These 3 Verses of the Qur’an, speak about the various embryological stages in great detail. First the nutfa placed in a place of security - Made into an ‘Alaqa’, Alaqa has got 3 meanings - One is ‘something’ which clings’, and we know that in the initial stages, the embryo clings to the uterine wall and continues clinging till the end. Point No.2, that it also means a leech like substance, and as I discussed earlier, the embryo in the initial stages, does look like a leech. Besides looking like a leech - it also behaves like a leech - It receives its blood supply from the mother’ like a bloodsucker. And the 3rd meaning ‘the congealed clot of blood’ Today…after advancement of embryology, even Dr. Keith Moore - He says that… ‘In the initial stages, the embryo, besides looking like a leech, also looks like a congealed clot of blood, because in the initial stages, of the stage of ‘Alaqa’, 3 to 4 weeks, the blood is clotted within closed vessels. This is exactly what Professor Keith Moore said… ‘Looks like a clot, in which the blood is clotted within closed vessels And during the 3rd week of the embryo, the blood circulation does not take place - it starts later on - Therefore it assumes the appearance of a clot. And if you observe the conspectus - that is after abortion takes place, you can see, it look like a clot. Only one line answer is sufficient to answer all the allegations of Christian missionaries is that, the stages of the Qur’an while it describes the embryological stages, is only based on appearance… Appearance. First is the appearance of the ‘Alaqa’ , a ‘leech like substance’ as well as a clot of blood.’ Some ladies come and ask… ‘Please remove the clot’ - It does look like a clot And the stages are based on appearance. It is created from something, which appears like a clot, which appears like a leech, and is also something which clings. Then the Qur’an says… ‘We made the ‘Alaqa’ into ‘Mutga’ – a chewed like lump.’ Professor Keith Moore took plastic seal, and bit between his teeth to make it look like a ‘Mutga’- The teeth marks resembled the ‘somites.’

"Look at what the greeks new:"

The point to be noted - Just because someone says something, which are matching with the Qur’an, that does not mean that Qur’an has been copied from that. Suppose I make a statement… suppose, if I make a statement, which is correct, which was said by somebody else earlier - That does not mean I have copied. It may be, It may not be. To use the conflict approach with the Qur’an… ‘Yes! He copied’ - Okay fine - But lets analyze. The Qur’an does not take the things which were wrong from Hypocrites.If he would have copied, he would have copied everything - it is logical. Unless he is a scientist… ‘Okay this is correct… Oh! This is wrong I won’t copy that - This is correct, I will copy that.’All the stages of Hypocrites, and Gallon is not the same as the Qur’an - Hypocrites and Gallon does not speak about ‘leech like substance.’ They do not speak about ‘mudgah’ at all - Where do they speak? Hypocrites and Gallon, at that time, they said that… ‘Even the women have got semen’ - who says that? - Even the Bible says that. If you read in the Bible, it is mentioned in Leviticus Chapter No.12, Verse No.1 to 12, that woman gives out seed - So actually Bible is copying from Hypocrites.And Bible says in Job… Bible says in Job, Chapter No.10, Verse No.9 and 10, that… ‘We have made the human beings from clay, like poured out milk and curdled cheese.’Poured out milk and curdled cheese, is exact plaguerisation from Hypocrites.Why plaguerisation? - Because surely that is not the word of God - That portion is unscientific.It was said by Hypocrites and Gallon, the Greeks, that… ‘Human beings are created like curdled cheese’ - And Bible copies that exactly.But Qur’an Alhamdulillah, and if you analyze and read the books on ‘Embryology, even of Dr. Keith Moore, he said that… ‘Hypocrites and the other people like Gallon, etc, they did give a lot of thing to embryology, initially, as well as Aristotle’ - Many were right, many were wrong.’And further he goes to says… ‘In the middle ages, or at the time of the Arabs, the Qur’an speaks about something additional.’ If it was exactly copied, why would Dr. Keith Moore in his book, give due credit to the Qur’an.He even gives due credit to Aristotle, to Hypocrites - but mentioned there… ‘Many were wrong.’ That, he does not mention with the Qur’an. That is enough proof, that Qur’an was not copied from the Greek time.

[HeiGou]

Which reflects extreme deficiency of knowledge in the writer's part. You are actually living in 1850's and don't want to come to modern age, for you'll have to accept God. Closing your eye's to reality cannot cure you from any disease.

And yet scientists can still produce much better lens than the human eye. Most cameras have much better lens than the human eye. Simply denying it does not change that fact.

Just because you cannot understand something doesn’t mean that thing is childish. I was referring to the comparison of natural eye with human-made technology, the TV, the monitors, the LCDs etc.

Well you weren't, whatever Intelligent Design website you cut and pasted from did. But that is simply wrong - it is not comparing like with like. The eye is a very different object to a TV screen or an LCD. And it is also wrong in the factual sense - TVs can be made with great resolution than the human eye. There is just not a lot of need for it as we can't see the difference anyway given the limitations on the human eye.

And that reflects complete illogicalness and lack of knowledge of the writer. And so I had replied that it’s not that much of a simple structure (the eye) its way more complicated.

I am having trouble working out how this relates to anything I have said. Remind me please.

It’s like we dreaming right now. How many people write posts while they are asleep? Have you ever seen an image, taken or recorded from such a camera, which is so vivid and clear and sharp that you cannot differentiate whether it’s an image on a screen or is it a real thing? The brief answer is: “NO”, and by all means its impossible to do it. If yet this sharpness is not achieved, after which hundreds and thousands of people are working on, then how can you imagine that the eye came into existence just coincidently? Its illogical.

It is not impossible. It is, in fact, highly possible. I have also seen images taken of distant objects which the human eye could not possibly hope to see. The problem with clarity as a measure is that I can only see objects with my eyes which are, as I have pointed out, not very good. So if the picture was even better than what the human eye can see, how would anyone know?

First of all, I did not talk about the range of eye to be compared with satellite. I wrote about the sharpness of image.

Evidently the two are linked.

No matter how advanced Television you have, you can clearly differentiate between the image on the TV and a real object. So therefore, with all the technology science has got, yet you cannot have anything like the natural eye.

You have only been dealing with low-definition TV. High-definition is expensive and takes up bandwidth so TV companies do not broadcast it. That says nothing about what humans can do, just what is economic. Again it is not hard to produce TV screens with high-definition than the human eye. There just is not a lot of call for it considering the audience cannot tell.

Next, seeing through a long distance too doesn’t prove any superiority of anything.

Well yes it does actually. It proves the superiority of lens makers.

If the eye you are referring to (The satellite etc) is created in this much span of time, with countless number of people involved in it, how can you assume the real eye be created just coincidently?!?

Because the eye is such a bad piece of design - it could not, or at least in unlikely to be, the work of a designer.

How did the cell feel the need of seeing? How? And how come everything, ever since they have started to evolve contains eyes? It should have been so for some species. Such wonderful tool should have evolved way later in the span of time. Earlier shapes of the living thing shouldn’t have had such things.

There is a lot of debate about how creatures first came to see. Plants manage to orient themselves towards the Sun so they must have some sort of detector. The first organisms would have wanted to know where the sun was too - to bask in its warmth for instance. To hide when night came. It might also help to know which way was up. So those organisms which could detect the sunlight would do better than those which did not.

You're living in 19th century, like I said, closing your eyes to reality will do nothing at all.

Mr Pot meet Mr Kettle.

I already wrote above, that the image formed by the eye is way much sharper than any other image formed by any LCD or anything. This is a sufficient proof that the eye is much more superior to anything else available today.

If it were true you might have a case. It is not and you do not.

How many people know about Salim Ali? How many? He forgot to mention that he was an Indian. Who knows about Stanley Cohen? Who? Anybody here? Raise your hands. Are these people worth mentioning? Its like I say, oh my neighbor, he disagrees with gravity, therefore we have scientists who disagree with gravity and that’s why, gravity is a conflicting theory.

Your ignorance is not my fault. Nor is the inability of the Muslim world to produce real scientists.

If you would have “JUST READ” my post, you could have pointed out at least 3 – 5 biologists who disagreed with Darwin.

Really? Who?

1)Patrick Glynn

You mean this (entirely non-biologist) Patrick Glynn?

Patrick Glynn is Associate Director of the George Washington University Institute for Communitarian Policy Studies in Washington, DC. He has written widely on politics, culture, religion, and international affairs for such publications as The New Republic, Commentary, The Washington Post, The National Interest, the Times Literary Supplement, First Things, and National Review. He has appeared frequently on network news and public affairs shows, including "ABC World News Tonight," "NBC Nightly News," "CBS Evening News," "This Week," and CNN. He has been an Advisor to the World Economic Forum and a Resident Scholar at the American Enterprise Institute for Public Policy Research. In the 1980s, he served in the Reagan Administration as Special Assistant to the Director of the U.S. Arms Control and Disarmament Agency. He is the author of Closing Pandora’s Box: Arms Races, Arms Control, and the History of the Cold War and, more recently, God: The Evidence: The Reconciliation of Faith and Reason in a Postsecular World. A summa cum laude graduate of Harvard College, he studied at Cambridge University on a Henry Fellowship and also holds A.M. and Ph.D. degrees from Harvard University.

2) Bryce Christensen

You mean this (entirely non-biologist) Bryce Christensen?

Dr. Bryce Christensen

Contributing Editor, The Family in America

Dr. Christensen served as editor of The Family in America from 1987 through 1995, and a regular contributor to the New Research supplement during the following two years. From 1982 through 1986, he also served as an editor of Chronicles magazine. He is the author of Utopia Against the Family: The Problems and Politics of the American Family, and editor of four other volumes: When Families Fail: The Social Costs, The Retreat From Marriage, Daycare: Child Psychology and Adult Economics, and The Family Wage.

At present, he is director of the English Language Study Center at Southern Utah University. He is a contributing editor to Modern Age and has written for the Wall Street Journal, USA Today, the Chicago Tribune, New York Newsday, and the Baltimore Sun.

He received his B.A. from Brigham Young University and his M.A. and Ph.D. from Marquette University.

3) George Politzer

You mean the (entirely non-biologist) French philosopher of the same name or the Hollywood actor?

4)Henry Margenau

You mean the Quantum mechanics-rejecting Yale Professor of Physics? He would be a non-biologist wouldn't he?

5)John Maddox

You mean this John Maddox?

Sir John Royden Maddox (born November 27, 1925 in Penllergaer, Swansea, Wales), a trained chemist and physicist, is a prominent science writer. He was an editor of Nature for 22 years: from 1966-73 and from 1980-95.

6)H. P. Lipson

He wouldn't be another physicist would he? Care to look up the article your HY article claims he wrote?

7) Paul Davies

Another physicist? Who does not, as it happens, reject Evolution.

8) W. Press

Got any more information on this guy? Like a first name?

9)And last, but not least: “Charles Darwin.”

Who, still, no matter what Mr Yayha says, did not reject evolution.

So not one biologist among them - Darwin apart - and several of them not saying you claim they said. Neat.

You just keep counting them and the list won’t end.

How about starting with one biologist and moving on from there?

[quopte] Oh My! There we have it again. Another self assumption, backed up with NO FACT at all. [/quote]

Mr Pot meet Mr Kettle.

Secondly, I need not to prove anything to you. I am not here to make you a God-Believing or a Muslim. Seriously, I don’t give a damn about it. My job is only to show you the truth, you agree with it, well and good, you don’t, I don’t care at all. I’m never going to worship my self (by following my emotions) and neither are you going to worship that which I worship, nor will I worship that which you worshiping, nor will you worship that which I worship. For you is your way, for me is mine.

For someone who does not care what I think (not believe by the way) you are getting awfully het up. Why are you here peddling these half-truths if you do not care?

Why do atheists have no problem in lying?

Irony?

The first microscope was invented by Hans and Zacharias Jansen, a father and son who operated a Dutch lens grinding business, around 1595. Their first microscopes were more of a novelty than a scientific tool since maximum magnification was only around 9X and the images were somewhat blurry. You expect them to prove SG wrong with this:

?!? Are you awake?!?

Umm, no because that microscope, was not built by the Jansens, but by Leeuwenhoek. As I said. As I said, as soon as the microscope was invented, and by your own admission the Jansens only invented a toy, not a scientific tool, it proved SG wrong. So your full of bluster, or something else, but you are simply proving my point. You were wrong about Pastuer. Accept it.

It was Antony Van Leeuwenhoek, a Dutch draper and scientist, and one of the pioneers of microscopy who in the late 17th century became the first man to make and use a real microscope. He made his own simple microscopes, which had a single lens and were hand-held. Van Leeuwenhoek outdid his contemporaries by developing ways to make superior lenses, grinding and polishing a small glass ball into a lens with a magnification of 270X.

So you are agreeing with me. Fine. Why are you wasting my time with this?

Point # 1: There was no such microscope with which they might have proven SG wrong.

Sorry? Two hundred years before Darwin? Yes there was - you have a picture of it above.

Point # 2: I gave a reference Louis’s book, which he wrote 5 years after Darwin’s book, which is quite convincing, since why would Louis do a research on something that has already been proved? It’s illogical. Come up with facts.

Because Pasteur was not researching SG, which had been proven wrong 200 years earlier, but bacteria. Ask a dumb question, get a dumb answer.

[HeiGou]

Now look at this... WHY DON’T YOU PEOPLE BE A BIT MORE PRACTICLE? We have marathon runners, don’t we? Are their children by birth fast in running? NO! Therefore natural selection is nothing to do with evolution.

How long have people been running marathons? Do the losers all die? Do the winners have dozens and dozens of children? What does natural selection have to do with this? Are you asking a silly question?

Yea right, because horses were actually evolved from crabs, right? How stupid can an atheist be? Of course horses, according to Charles Darwin, are a modified form of dears and goats.

Really? Where does Darwin say that? Care to trace out the tree from crabs to horses?

I sometimes ask my self, why do I talk with atheists… but then I realize that its my job at least to tell them once that there is a life after death waiting for you, and so I continue doing it.

Well I would say I appreciate it but you couldn't convince my Grandmother.

Did you actually read what I wrote? “Natural selection can do nothing until favourable individual differences or variations occur.”

INDIVIDUAL DIFFERENCES OR VARIATIONS OCCUR. Meaning on individual bases, there might be some changes, but on the whole race of the specie there won’t be an effect. Therefore the animal will not evolve any more. What the …. Confuses you?

No but I think perhaps you are confused. I agree that natural selection can do little until variations occur. But luckily they occur all the time. If enough of them occur of course there will be a species wide change.

[czgibson]

Greetings,

Oh My! There we have it again. Another self assumption, backed up with NO FACT at all. Every brief quote needs not to be a quote out of context. You are assuming your self that it’s out of context and with context it will mean something else. Why don’t you just prove it wrong? And while you can’t, you’re on the wrong side. I’ve given a quotation with page number, all you have to do is go and get the book and read the context, and then tell everybody what the real context is. Since you’re not doing it, you’re not right. Your argument means nothing to anybody. When you will have it done, when you will have it proved, only then your this argument may hold some weight.

Here's the quote you've given:

British paleontologist, Derek V. Ager, admits this fact, even though he is an evolutionist:

"The point emerges that if we examine the fossil record in detail, whether at the level of orders or of species, we find—over and over again—not gradual evolution, but the sudden explosion of one group at the expense of another." (Derek Ager, "The Nature of the Fossil Record", Proceedings of the British Geological Association, vol 87, 1976, page. 133.)

To use this as an argument against Darwinism shows no acknowledgment of the context, or indeed background knowledge about evolution. As HeiGou has pointed out, this is an expression of the theory of punctuated equilibrium (also known as Punk Eek). This is an expansion and partial modification of Darwin's ideas - it disagrees with him in some areas and agrees with him in others.

Muhammad Waqqas, you often assume that your opponent in debates is stupid, when in fact it is more often you who is wrong. Please don't just assume that you know everything; you don't. None of us does.

Peace

[root]

Now look at this... WHY DON’T YOU PEOPLE BE A BIT MORE PRACTICLE? We have marathon runners, don’t we? Are their children by birth fast in running? NO! Therefore natural selection is nothing to do with evolution.

That is a very poor analogy if you ask me.

You state "Natural selection is nothing to do with evolution".

This statement is of course utter nonsense (like most of your post). Natural selection relies on the survivel of the fittest & luckiest, what survival is gained by a marathon runner in the first place. Additionally, why was man not running 100 metres 30 years ago in under 10 seconds yet now it is a routine time!

can you logically explain this following point:
http://www.islamicboard.com/comparat...nightmare.html

A quick update though, these little critters are now on the doorstep of one of Australia's well known city "Darwin". Quite ironic I would say!

[IceQueen~]

"atheism, darwinism and any other 'ism' are all based on the assumption (the incorrect assumption) that the universe is infinite. with the discovery of the bib bang, this means that the base fort he 'isms' is shattered so in effect all the 'isms' are baseless!!"

[IbnAbdulHakim]

^


:sl:
I had alredy mentiond this before and i said if the universe is infinite then how did the first universe come to be?
:w:

[root]

I had alredy mentiond this before and i said if the universe is infinite then how did the first universe come to be?

What do you mean exactly when you say

"If the universe is infinate"? Additionally, what has this actually got to do with the theory of Evolution?

Regards

Root

[HeiGou]

I had alredy mentiond this before and i said if the universe is infinite then how did the first universe come to be?

Well the Universe is not infinite. It is bounded - it started with the Big Bang and everything has been moving outwards from that point ever since.

Do you mean the theory there are infinite numbers of Universes or that the Universe has been through an infinite number of Big Bangs and Big Crunches? In which case is this is subtly hidden "First Cause" argument?

[HeiGou]

"atheism, darwinism and any other 'ism' are all based on the assumption (the incorrect assumption) that the universe is infinite. with the discovery of the bib bang, this means that the base fort he 'isms' is shattered so in effect all the 'isms' are baseless!!"

In what sense are atheism, Darwinism or any other "ism" based on the assumption that the Universe is infinite? Neither atheism or Darwinism are in any way threatened by the idea that the Universe is, or is not, infinite.

This has to be one of the least well expressed and perhaps thought out arguments I have heard for some time.

[IbnAbdulHakim]

Well the Universe is not infinite. It is bounded - it started with the Big Bang and everything has been moving outwards from that point ever since.

Do you mean the theory there are infinite numbers of Universes or that the Universe has been through an infinite number of Big Bangs and Big Crunches? In which case is this is subtly hidden "First Cause" argument?

:sl:

You obviously believe in infinite space right therefore creating infinite possibilities? Therefore i ask you how did existence itself come to be?

:w:

[Ghazi]

:sl:

To the athiest's ask your selfs this, imagine that you were right and there was no god, and there was no day of judgment and no punishment in the grave and you died along with the rest of the muslims, But imagine you were wrong and us muslims were right, tell me this what have you got to loose by following islam, if were right you get the benifit of being a muslim if were wrong nothing happens so why do you disbelieve.

[czgibson]

Greetings,

To the athiest's ask your selfs this, imagine that you were right and there was no god, and there was no day of judgment and no punishment in the grave and you died along with the rest of the muslims, But imagine you were wrong and us muslims were right, tell me this what have you got to loose by following islam, if were right you get the benifit of being a muslim if were wrong nothing happens so why do you disbelieve.

This is Pascal's Wager again.

If I only believed in Islam because of fear of hellfire if my atheism turned out to be wrong, what sort of faith would that be?

What have I got to lose by following Islam? If Islam turns out to be wrong, then I would have lived a life devoid of things that I enjoy, such as music, alcohol and bacon, for no reason at all. I would also have wasted a lot of time with prayer to a god that didn't exist.

Peace

[Ghazi]

Greetings,


This is Pascal's Wager again.

If I only believed in Islam because of fear of hellfire if my atheism turned out to be wrong, what sort of faith would that be?

What have I got to lose by following Islam? If Islam turns out to be wrong, then I would have lived a life devoid of things that I enjoy, such as music, alcohol and bacon, for no reason at all. I would also have wasted a lot of time with prayer to a god that didn't exist.

Peace

Salaam

Then All I can say is may allah guide you.

[IceQueen~]

In what sense are atheism, Darwinism or any other "ism" based on the assumption that the Universe is infinite? Neither atheism or Darwinism are in any way threatened by the idea that the Universe is, or is not, infinite.

This has to be one of the least well expressed and perhaps thought out arguments I have heard for some time.

this is a quote by some american(?) something-i need to go home and get the reference..

[IbnAbdulHakim]

Greetings,


This is Pascal's Wager again.

If I only believed in Islam because of fear of hellfire if my atheism turned out to be wrong, what sort of faith would that be?

What have I got to lose by following Islam? If Islam turns out to be wrong, then I would have lived a life devoid of things that I enjoy, such as music, alcohol and bacon, for no reason at all. I would also have wasted a lot of time with prayer to a god that didn't exist.

Peace

:sl:

I dont understand how you justify existence? Dont you toss and turn at night wondering how on earth did you come to be? How did existence begin??

:w:

[IceQueen~]

Well the Universe is not infinite. It is bounded - it started with the Big Bang and everything has been moving outwards from that point ever since.

Do you mean the theory there are infinite numbers of Universes or that the Universe has been through an infinite number of Big Bangs and Big Crunches? In which case is this is subtly hidden "First Cause" argument?

ur talking about the 'oscillating universe' but this theory cannot be used for time being infinite because this model holds that energy from the previous bang to crunch passes on to the next universe but gets less each time so it won't carry on forever which means that it has an end which means that it cannot be infinite!

[czgibson]

Greetings Abd'Majid,

I dont understand how you justify existence?

It's not something I'm all that concerned about, to be honest. I feel fairly sure that I exist in the world, which also exists. That's the situation I find myself in - in what sense do I need to justify it?

Dont you toss and turn at night wondering how on earth did you come to be?

No - that's simple. I was created by the union of gametes from my parents.

How did existence begin??

A mystery - nobody knows. The Big Bang is the earliest situation we know of, but is it really the beginning?

Peace

[IbnAbdulHakim]

A mystery - nobody knows. The Big Bang is the earliest situation we know of, but is it really the beginning?

:peace:

Nope its certainly 100% not the beginning becoz u believe that particles where used to create the bang so those particles where in space right? And those particles came from somewhere and then if u manage to answer that u can ask where did the ones b4 the particles come from? You see we need a SOURCE of life!! A beginning, just think... duz it make sence... to not believe in God?

:peace:

[czgibson]

Greetings,

You see we need a SOURCE of life!! A beginning, just think... duz it make sence... to not believe in God?

What do you mean we need a source of life? We observe life around us, but we don't know how it began. Why assume that god must be behind it all when nobody actually knows that? It's the fallacy of the argument from ignorance.

Peace

[IceQueen~]

Greetings,


What do you mean we need a source of life? We observe life around us, but we don't know how it began. Why assume that god must be behind it all when nobody actually knows that? It's the fallacy of the argument from ignorance.

Peace

the red shift discovery meant that if we go back in time we will get to a single point with zero volume because of it's immense density, 'zero volume' is tantamount to saying 'nothing'. this means that the big bang came out of NOTHING! how is that logical? why did it happen? HOW did it happen?
the universe had a beginning, which means that it is CREATED SO IF IT'S CREATED THEN BY WHO?

[IceQueen~]

"it is the same, whether you warn them or you do not warn them, they will not believe"quran surah2

[IbnAbdulHakim]

:You need at least a doctor of medicine and an expert of social behaviour at the same time to talk about such behaviours and their fatal consequence. Muhammad (Peace be upon him) was neither of them, but a Prophet of God who didn’t copy from the Bible and paste in the Quran and foretell the same fate of perverts of Sodom and Gomorrah for the future perverts, but a unique disease never heard or known by earlier people, AIDS! The medical scientists are unanimous that this disease is never recorded in the annals of history.

^ This is about aids, just on that one topic, you cant even deny the quran is the true word of Allah swt! Just on that one... i have given much more proofs then that but look... subhanAllah HOW CAN YOU DENY ALLAHS FAVOURS?! The favours of your Lord!

:peace: :sl:

[Ayesha Rana]

post deleted

----- I read in the Riyad-us-Salihin Hadith book by Imam Nawawi that whoever judges by the Quran is fair, whoever argues by the Quran wins...and one other i can't remember. Well May Allah help you.

[Ghazi]

Salaam

Islam is the key to success without it your doomed what is this live but a couple of years, whats the avarge life span 70 years whats this compared to hearafter czgibson I hope to see you on judgment day in a good situation so plz for your sake save your self you've got the opertunity don't let it pass you by the shahada is the golden ticket to succest without the gates of janna won't be open to you.

[HeiGou]

You obviously believe in infinite space right therefore creating infinite possibilities? Therefore i ask you how did existence itself come to be?

I do not believe in infinite space or infinite possibilities. And I do not see how it affects the question of existence.

[HeiGou]

the red shift discovery meant that if we go back in time we will get to a single point with zero volume because of it's immense density, 'zero volume' is tantamount to saying 'nothing'. this means that the big bang came out of NOTHING! how is that logical? why did it happen? HOW did it happen?
the universe had a beginning, which means that it is CREATED SO IF IT'S CREATED THEN BY WHO?

Actually you have that backwards - all matter being compressed into a single point with zero volume is usually referred to as a singularity - meaning its mass is infinite even if its volume is zero (or rather as volume approaches zero, the density increases towards infinity). It is a hard concept to understand but not as hard as the concept of God.

Why does something that has a beginning need to be created?

[IbnAbdulHakim]

I do not believe in infinite space or infinite possibilities. And I do not see how it affects the question of existence.

:peace:
becoz that makes the chances of existence 0.00000000000000001! If you dont believe in infinite possibilities...
:peace:

[HeiGou]

becoz that makes the chances of existence 0.00000000000000001! If you dont believe in infinite possibilities...

I am here. You are there. The chances we exist are precisely one. What do you mean?

[root]

Your source (why did u just cut n paste):
-----

Either engage in debate with your own thoughts & logic or read this:

(I will just provide the link instead of doing a cut n paste)

http://www.crystalinks.com/quatrains...retations.html

Good Luck Refuting!

PS:

AIDS:
"It never happens that permissiveness overwhelms a people to the extent that they display their acts of sex shamelessly

So how comes a substantial non permissive men women children and babies became infected through blood transfusions, & how comes Human AIDS originates from bush meat!

[IbnAbdulHakim]

I am here. You are there. The chances we exist are precisely one. What do you mean?

:peace:

The big bang theory, the chances of that happening are close to NOTHING, it had to be planned and dun purposely! Thats what i mean!

:peace:

[IbnAbdulHakim]

Your source (why did u just cut n paste):
http://www.------------/library/articles/prophecies.html

Either engage in debate with your own thoughts & logic or read this:

(I will just provide the link instead of doing a cut n paste)

http://www.crystalinks.com/quatrains...retations.html

Good Luck Refuting!

:peace:

My thoughts are wen such clear signs are shown how can people deny them, so i wanted to show you. Im sry for wasting space but i thot it better to just show you outright!

The link you gave is a :? :? why did u give that?

:peace:

[root]

The big bang theory, the chances of that happening are close to NOTHING, it had to be planned and dun purposely! Thats what i mean!

Can you provide a source please?

really interested.

[root]

My thoughts are wen such clear signs are shown how can people deny them

So you believe in the prophecies of nostradamus then? :-)

[IbnAbdulHakim]

So you believe in the prophecies of nostradamus then? :-)

:peace:

lol not really, dont kno much bout his stuff, let me get bak to u :)

:peace:

[IbnAbdulHakim]

Can you provide a source please?

really interested.

:peace:

I heard it from dr.zakir naik who explained it beautifully wait let me get a referance 4 u.

:peace:

[HeiGou]

The big bang theory, the chances of that happening are close to NOTHING, it had to be planned and dun purposely! Thats what i mean!

Why do you think that about the Big Bang when the causes of it are so poorly known. But again you are missing the point: I am here writing this, you are there reading this. We would not be if not for the Big Bang. Therefore the chances that the Big Bang did occur are roughly one. You cannot look back on what happened and claim it as a miracle. Suppose I flip a coin a thousand times and get HTHHTTHTTTHTHHTHTHTHTHetc. The chances of getting exactly that sequence is pretty small. Would it be a miracle if I did?

[IbnAbdulHakim]

lol 3 aethiests bombarding, lol inshaAllah i'll post up refutations in due time. :brother:

[czgibson]

Greetings,

lol 3 aethiests bombarding,

Your challenge has been accepted, as you can see.

lol inshaAllah i'll post up refutations in due time. :brother:

You might find it easier to do this if you used your own thoughts to begin with. It was a disappointment to find out that you'd just copied that article from someone else.

Peace

[HeiGou]

It was a disappointment to find out that you'd just copied that article from someone else.

And somebody who did not, as far as I can see, quote the Quran correctly. All the verses seem to be out a little. As well as quoted out of context.

[Muhammad]

Greetings Callum,

Sorry for the delayed reply!

I'm not so sure. It takes an awful lot of confidence to say that you know where the universe came from. I don't have that confidence, and neither do most scientists and philosophers. Where there is a lack of evidence, we should say that we simply don't know, rather than ruling out all other possibilities that don't fit with our hypothesis.

I agree: where there is a lack of evidence, we cannot be sure. Yet when there is ample evidence, then confidence follows.

I suppose that's possible, if someone was raised in a strongly atheist family or something. I've not heard of such a case outside of Communist dicatatorships, though.

I doubt that such people would openly proclaim their intentions, since they are hiding something that is true. The pagan arabs in the time of the Prophet Muhammad (peace be upon him) were examples of people in denial: they recognised Allaah as their Creator, yet they disobeyed Him. The last verses of Chapter 29 are quite relevant:

[29.61] And if you ask them, Who created the heavens and the earth and made the sun and the moon subservient, they will certainly say, Allah. Whence are they then turned away?
[29.62] Allah makes abundant the means of subsistence for whom He pleases of His servants, and straitens them for whom (He pleases) surely Allah is Cognizant of all things.
[29.63] And if you ask them Who is it that sends down water from the clouds, then gives life to the earth with it after its death, they will certainly say, Allah. Say: All praise is due to Allah. Nay, most of them do not understand.
[29.64] And this life of the world is nothing but a sport and a play; and as for the next abode, that most surely is the life-- did they but know!
[29.65] So when they ride in the ships they call upon Allah, being sincerely obedient to Him, but when He brings them safe to the land, lo! they associate others (with Him);
[29.66] Thus they become ungrateful for what We have given them, so that they may enjoy; but they shall soon know.
[29.67] Do they not see that We have made a sacred territory secure, while men are carried off by force from around them? Will they still believe in the falsehood and disbelieve in the favour of Allah?
[29.68] And who is more unjust than one who forges a lie against Allah, or gives the lie to the truth when it has come to him? Will not in hell be the abode of the unbelievers?
[29.69] And (as for) those who strive hard for Us, We will most certainly guide them in Our ways; and Allah is most surely with the doers of good.

In my own case, it would have been easier for me if I had believed in god - all those hours spent in church at my (Catholic) school wouldn't have seemed like such a monumental waste of time.

I am sorry to hear that is how you feel, yet on the other hand: you say that you will not become a Muslim because you will have to give up many things you enjoy. Here is an example of disbelief in God furthered by wordly pursuits rather than outright evidence, making it more desirable not to believe.

That's not what I'm doing. I'm comparing them to the proof of Pythagoras' Theorem.

I think that was what I meant, sorry.

Also, I think most of the standard arguments for god's existence have been covered on this and various other threads, haven't they?

Yes, they have, yet I very much doubt that an exhaustive attempt has been made to explain them or that all of them have in fact been covered. If we take the Qur'anic miracles for example, we have not covered such aspects as its linguistic power and structure in sufficient depth as to prove its miraculous nature. I don't think there has been a thread detailing the exegesis and language of the Qur'an, although brief outlines pertaining to these subjects may have appeared in various places. If I was to relate this to Pythagoras' Theorem, the analogy would perhaps be that if a person does not understand algebra: the language of mathematics, then Pythagoras' concept would be poorly understood. Similarly, if we do not even have an understanding of Arabic, how are we able to really appreciate the nature of the Qur'an?

I'm not saying it's necessary, but is it somehow unacceptable?

I think it may be irrelevant in a way if we understand the concept of life being a test. If God's existence was so obvious that we saw Him day in day out, there wouldn't be a need to send down Prophets to remind us, nor would there remain much of a test by which good and bad are distinguished.

I'm afraid I'm not really sure what you're getting at here - would you mind elaborating?

I was probably trying to explain the above, but worded it poorly. Anyway, thank you for your reply :)

Peace

[Muhammad]

Greetings,

Regarding the issue of prophecies in the Qur'an: undoubtedly there are prophecies that have come true, however, the site from which the prophecies in question came seems to have misinterpreted some verses and simply by referring to exegesis of the Qur'an, we can understand the true message behind these verses. Many times people far-fetch translations to make a point, yet there is no need; the message conveyed by the Qur'an is clear and plain. We need to bear in mind that such verses are to be understood as those who had the best understanding understood them: the Prophet (peace be upon him) and his companions.

There are plenty of other miracles to discuss regarding the Qur'an, which we can hopefully do so in the near future.

Peace.

[IbnAbdulHakim]

Greetings,

Regarding the issue of prophecies in the Qur'an: undoubtedly there are prophecies that have come true, however, the site from which the prophecies in question came seems to have misinterpreted some verses and simply by referring to exegesis of the Qur'an, we can understand the true message behind these verses. Many times people far-fetch translations to make a point, yet there is no need; the message conveyed by the Qur'an is clear and plain. We need to bear in mind that such verses are to be understood as those who had the best understanding understood them: the Prophet (peace be upon him) and his companions.

There are plenty of other miracles to discuss regarding the Qur'an, which we can hopefully do so in the near future.

Peace.

:sl:

Ye bro i realised this myself. Im trying to study the fulfilled prophecies and gain an understanding of them before posting further inshaALlah.

:w:

[root]

Greetings Abd'Majid,

I have a phrophecy for you that needs refuting:

Star-Trek correctly predicted the widespread use of mobile phones before the concept was ever invented:

And today we have them:

Years ago, Star Trek spoke about the "Ion Propolsion Drive System". Before it was ever invented, how did they predict this. Surely proof that Star Trek is proof that Klingons do indeed live out in another galaxy somewhere.... What do ya think :-) Is I mean how could star trek make an accurate prediction. :hiding: ;D :giggling:

[IbnAbdulHakim]

:peace:

^ oh yes predicting what was in the works, u genius :rollseyes

:peace:

[czgibson]

Greetings,

^ oh yes predicting what was in the works, u genius :rollseyes

Good luck refuting!

How can you deny this?

:p

Peace

[IbnAbdulHakim]

Greetings,


Good luck refuting!

How can you deny this?

:p

Peace

:peace:

Are you honestly trying to imply thats how ridiculous the prophecies sound to you? Because the level of difference is all to clear!

:peace:

[czgibson]

Greetings,

Are you honestly trying to imply thats how ridiculous the prophecies sound to you? Because the level of difference is all to clear!

In reference to the prophecies you quoted, I'm afraid that's precisely what I'm implying.

Peace

[IbnAbdulHakim]

Greetings,


In reference to the prophecies you quoted, I'm afraid that's precisely what I'm implying.

Peace

:peace:


In that case i ask you to give me one week to study the prophecies myself, i'll learn the tafseer (interpretation) and try to grasp a understanding, then we shall resume :)

:peace:

[czgibson]

Greetings Abd'Majid,

In that case i ask you to give me one week to study the prophecies myself, i'll learn the tafseer (interpretation) and try to grasp a understanding, then we shall resume :)

That sounds good to me, but with all due respect, perhaps you should have checked out the tafseer before you posted those prophecies in the first place.

Peace

[IbnAbdulHakim]

Greetings Abd'Majid,


That sounds good to me, but with all due respect, perhaps you should have checked out the tafseer before you posted those prophecies in the first place.

Peace

:sl:

I actually read them and thought they make sence, now i realise that i should look deeper into it. I'll make sure i get the context right, we'll hav a jolly good debate :p

:w: