Atheism

Is there evidence for the existence of God?

  • Total voters
    0
Status
Not open for further replies.
by evidence you are referring to adaptation of certain animals?
Click to expand...

Choose your words carefully, I am referring to the adaptation of all life.
 
really even humans
Click to expand...

Of course. Retro virus insertion matches between primate groups showing the same insertion point and the same degrading over time are extremely difficuly to explain other than through common descent. This of course is only a very small part of the scientific data.
 
root said:
Of course. Retro virus insertion matches between primate groups showing the same insertion point and the same degrading over time are extremely difficuly to explain other than through common descent. This of course is only a very small part of the scientific data.
Click to expand...

i see so you think that this similarity is evidence of humans being evolved thru primates?
 
i see so you think that this similarity is evidence of humans being evolved thru primates?
Click to expand...

Put it this way. If a retrovirus misfired it's DNA insertion into you that rendered it's insertion obsolete, you would carry this for the rest of your life. Your future off-spring will also carry a complete copy of the misfired insertion, (hypothetically - 10,000 years from now) your genetical data will have propogated through a large chunk of man who are by long distance still related to you and would still carry "perfect copies" of the retro virus misfire.

If 15,000 years from now a single person wondered if he shared ancestory directly from you and submitted his DNA to analyse the marker that would be your insetion misfire point and the result was that the person did have the exact gene sequence that the virus inserted, what would you conclude about the relationship of this future human and his relationship to you.

Just out of interest!
 
root said:
Put it this way. If a retrovirus misfired it's DNA insertion into you that rendered it's insertion obsolete, you would carry this for the rest of your life. Your future off-spring will also carry a complete copy of the misfired insertion, (hypothetically - 10,000 years from now) your genetical data will have propogated through a large chunk of man who are by long distance still related to you and would still carry "perfect copies" of the retro virus misfire.

If 15,000 years from now a single person wondered if he shared ancestory directly from you and submitted his DNA to analyse the marker that would be your insetion misfire point and the result was that the person did have the exact gene sequence that the virus inserted, what would you conclude about the relationship of this future human and his relationship to you.

Just out of interest!
Click to expand...

whoah this is embarassin but can you say that simply? sorry, found it difficult to understand unless your saying that how can primates and humans hav the same gene?
 
whoah this is embarassin but anyway to say that simply? sorry, found it difficult to understand unless your saying that how can primates and humans hav the same gene?
Click to expand...

Since you have not answered the question, perhaps I may draw a reasonable conclusion. If this hypothetical event occured within me, then I could only conclude that the ancestory alternatively that the person is a direct relative of mine.

As for humans and primates and especially chimps, yes they share a number of retrovirus insertions at the same letter sequence of the dna showing the same degrading over time. How is this possible? afterall the ONLY logical way that this could occur is by off-spring copies. Urangatangs also have them so the same insertions are present in these three primates. The fact further confirmed that urangutangs have less matches indicates they seperated form our ancestor before chimps and humans thus we conclude chimps as our closest living ancestor and the urangutang second.

To me, how can this be reasonably explained. The answer is the final nail in the creationist view that man does not have a common ancestor of primates.
 
root said:
Since you have not answered the question, perhaps I may draw a reasonable conclusion. If this hypothetical event occured within me, then I could only conclude that the ancestory alternatively that the person is a direct relative of mine.

As for humans and primates and especially chimps, yes they share a number of retrovirus insertions at the same letter sequence of the dna showing the same degrading over time. How is this possible? afterall the ONLY logical way that this could occur is by off-spring copies. Urangatangs also have them so the same insertions are present in these three primates. The fact further confirmed that urangutangs have less matches indicates they seperated form our ancestor before chimps and humans thus we conclude chimps as our closest living ancestor and the urangutang second.

To me, how can this be reasonably explained. The answer is the final nail in the creationist view that man does not have a common ancestor of primates.
Click to expand...

Ye they are closest but they are not one and the same, what i mean is there is no direct proof that we come from primates. For example two fishes of different species may look alike, the fact that they do may indicate they hav some of the same DNA or genetics, this however in no way indicates that one formed from the other. They are both still unique, both a different species altogether.

I hope that makes sence, cudnt use technical words like you :hiding:
 
Ye they are closest but they are not one and the same, what i mean is there is no direct proof that we come from primates.
Click to expand...

OK, point taken perhaps I am failing to clearly express my reasoning.

For example two fishes of different species may look alike, the fact that they do may indicate they hav some of the same DNA or genetics, this however in no way indicates that one formed from the other
Click to expand...

Your reasonably right in logic but not scientific data analysis and example would be that the closest living relative to the hippopotomus is the whale yet they do not look similar

They are both still unique, both a different species altogether.
Click to expand...

I hope you can stay with me as I expand a little on the retrovirus. A retrovirus in a simplistic term inserts a "copy" of it's DNA into it's host (you or me for example). What I mean here is that a section of your DNA is re-written by the virus. Here is a group of DNA letters:

ccctttaaataaattaattttttccccctttccaaatttccccaaaatttaaccccgggcggcaaaa

Let's say for aruement sake we took a very small portion from a specif area of your genome and mine to compare them. We would reasonably expect them to match in this manner

Your DNA

ccctttaaataaattaattttttccccctttccaaatttccccaaaatttaaccccgggcggcaaaa

My DNA

ccctttaaataaattaattttttccccctttccaaatttccccaaaatttaaccccgggcggcaaaa

The result we expect is a match. Now, let us add a retrovirus infects me and misfires and harmlessly inserts it's DNA into me and this little bit of DNA now shows itself in me but not you (since u was not infected). (I have bolded the change) in my DNA caused by the virus

ccctttaaataaattaattttttccccctttccaaatttttagaaaatttaaccccgggcggcaaaa

Now that I have this harmless DNA change in my genome, every child I bring into this world will copy this section of my DNA and every child you bring into the world carries your genome. (also remember your genome right now will not match mine 100%)

Now imagine 10,000 years into the future a modern man wishes to check if he is related to me or to you. And he has this DNA string checked and the result is:

ccctttaaataaattaattttttccccctttccaaatttttagaaaatttaaccccgggcggcaaaa

Based on the result, who is he related to?

I hope that makes sence, cudnt use technical words like you
Click to expand...

I hope this makes a little more sense for you to be able to answer the question
 
Last edited:
Say i accept what you sed. That we indeed hav those primates insertion in us sumwhere. How comes we are different on so many other levels.

Intelligence,

patience,

looks.

They should have quite a few more similar genes or insertions then just that. Dont you think the change is a bit too vast? or do u think it happened ova such a huge amount of time that the process was completely gradual?
 
Say i accept what you sed. That we indeed hav those primates insertion in us sumwhere. How comes we are different on so many other levels.
Click to expand...

Goog question

They should have quite a few more similar genes or insertions then just that. Dont you think the change is a bit too vast? or do u think it happened ova such a huge amount of time that the process was completely gradual?
Click to expand...

I have bolded what I think is the answer. It's not just a gradual change as it involves a change in actual species, if me and you were to get hold of a time machine and go back a thousand years to pick up our closest ancestor and then move another 1000 years to pick up another closest ancestor and drop off the one we have. If we keep doing this at 1000 year intervals within say 600,000 years you and I would probably not be able to "procreate" with the common ancestor however the common ancestor (the one we keep picking up every 1000) years would still be able to procreate.

Time is a concept man does not really have the ability to grasp. Sure we understand how long a day is, a month or even a year. Perhaps we may be able to understand (just) 100 years, what about 1000. 1 million or even 700million years. For example, if I had a pole of steel in similar shape and size to a pole vaulters pole and once a day I rubbed it once at a specifc end with a silk cloth. How long would it take before the pole has been completely rubbed away by friction?

What about time represented in steps. I live in Scotland, if 1 step represents 1000 years then my first step outside the house takes me to the year 1006, a second step takes me to the birth of christ. To get back in time to our evolutionary beginning I would need to keep walking all the way to london some 500 miles away.
 
Salam,
This is really wierd,
Allah has honered Adam(PBUH) and the his children. So why then do people want to believe that thier origin is from an animal.
question for root.

If I took pieces of a car(expensive and high tech) and left it for a million years, or shook it here and their would it come together? no.
because something needs control the energy.
samething with life.
who controls. if there is no control there is no life.
 
anis_z24 said:
Allah has honered Adam(PBUH) and the his children. So why then do people want to believe that thier origin is from an animal.
Click to expand...

I do not think it is a question of wanting to believe anything. It is a question of following the evidence and believing in what science can prove.

If I took pieces of a car(expensive and high tech) and left it for a million years, or shook it here and their would it come together? no.
because something needs control the energy.
samething with life.
who controls. if there is no control there is no life.
Click to expand...

Except you are making a wrong comparison. Suppose you did not know anything about how the car worked. But you assembled it to the best of your ability. But every time you put a piece in the wrong place you got an electric shock and every time you got a piece in the right place you got a piece of chocolate. How many millions of years do you think it would take before you put the car back together correctly - even though you knew nothing about how the car was supposed to go?

With evolution it is similar except there is no end goal (a proper car) nor is there such beneign punishments and rewards. If an individual makes a bad choice, they die and hence have few or no children. If they make a good choice, they survive and hence have more children. Instead of electric shocks, you have predators eating you. Instead of chocolate, you have sex. Same principle. You do not need a directing intelligence.
 
question for root.

If I took pieces of a car(expensive and high tech) and left it for a million years, or shook it here and their would it come together? no.
Click to expand...

Nope. Agreed you are into an eternal loop

because something needs control the energy.
Click to expand...

Don't see the relavence. Am I missing something.

samething with life.
who controls. if there is no control there is no life.
Click to expand...

I disagree. I take it this (expensive and high tech) "car" would have a nice paint job. If the creator of the car did not exist would the chemical structure of the paint "exist"?

If the creator of "man" never existed, would our chemical structure still exist?

"Answers on a postcard please"
 
With evolution it is similar except there is no end goal (a proper car) nor is there such beneign punishments and rewards. If an individual makes a bad choice, they die and hence have few or no children. If they make a good choice, they survive and hence have more children. Instead of electric shocks, you have predators eating you. Instead of chocolate, you have sex. Same principle. You do not need a directing intelligence.
Click to expand...

And I would imagine that this is the reason that all offspring from a lion and tiger mating are infertile.
 
And I would imagine that this is the reason that all offspring from a lion and tiger mating are infertile.
Click to expand...

To be honest I don't know much about this issue. I know that when a species is seperated and they evolve indapendantly of each group an important milestone on the way to becoming a seperate species is the inability to interbreed, perhaps lions and tigers are still in the late process of reaching this whilst recognised already as a seperate species.

I would be very very surprised if it never occured that an offspring between the two was done, as it has been in captivity. Perhaps the selection pressures and survivability in the wild is just too much.

Anyways, here is a Ligon (tiger & lion) hybrid:

ligon.jpg
 
To be honest I don't know much about this issue. I know that when a...
Click to expand...

I'm jumping in the discussion so if I miss something, correct me.

Regarding evolution, theory of evolution is already dead. First of all, darwin him self did not agree with his own theory. He clearly started that in his book.

Actually, I would rather want to listen to some logics that an athiest gives for being an athiest. I've talked with several athest, and not a single thing they told me made any logic. I hope you're going to be more logical.
 
Status
Not open for further replies.

Similar Threads

Back
Top